ID: 1031971675

View in Genome Browser
Species Human (GRCh38)
Location 7:128069076-128069098
Sequence GGATCTGTGCAGGTGGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031971666_1031971675 13 Left 1031971666 7:128069040-128069062 CCCTGTGATGGGGAAAGACCTCC 0: 1
1: 0
2: 1
3: 19
4: 213
Right 1031971675 7:128069076-128069098 GGATCTGTGCAGGTGGTACAGGG No data
1031971660_1031971675 26 Left 1031971660 7:128069027-128069049 CCCACCGCTTTGGCCCTGTGATG 0: 1
1: 0
2: 0
3: 16
4: 201
Right 1031971675 7:128069076-128069098 GGATCTGTGCAGGTGGTACAGGG No data
1031971661_1031971675 25 Left 1031971661 7:128069028-128069050 CCACCGCTTTGGCCCTGTGATGG 0: 1
1: 0
2: 0
3: 5
4: 130
Right 1031971675 7:128069076-128069098 GGATCTGTGCAGGTGGTACAGGG No data
1031971667_1031971675 12 Left 1031971667 7:128069041-128069063 CCTGTGATGGGGAAAGACCTCCA 0: 1
1: 0
2: 1
3: 16
4: 100
Right 1031971675 7:128069076-128069098 GGATCTGTGCAGGTGGTACAGGG No data
1031971670_1031971675 -5 Left 1031971670 7:128069058-128069080 CCTCCACTGAAGAGAAAGGGATC 0: 1
1: 0
2: 2
3: 15
4: 399
Right 1031971675 7:128069076-128069098 GGATCTGTGCAGGTGGTACAGGG No data
1031971671_1031971675 -8 Left 1031971671 7:128069061-128069083 CCACTGAAGAGAAAGGGATCTGT 0: 1
1: 0
2: 1
3: 21
4: 204
Right 1031971675 7:128069076-128069098 GGATCTGTGCAGGTGGTACAGGG No data
1031971665_1031971675 22 Left 1031971665 7:128069031-128069053 CCGCTTTGGCCCTGTGATGGGGA 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1031971675 7:128069076-128069098 GGATCTGTGCAGGTGGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031971675 Original CRISPR GGATCTGTGCAGGTGGTACA GGG Intronic
No off target data available for this crispr