ID: 1031972496

View in Genome Browser
Species Human (GRCh38)
Location 7:128074724-128074746
Sequence TAGTGTGTGAGGAGGACGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031972496_1031972502 4 Left 1031972496 7:128074724-128074746 CCTCCCGTCCTCCTCACACACTA 0: 1
1: 0
2: 1
3: 16
4: 299
Right 1031972502 7:128074751-128074773 TGCTGCCTCCAGAGAACAGGAGG 0: 1
1: 0
2: 2
3: 35
4: 265
1031972496_1031972501 1 Left 1031972496 7:128074724-128074746 CCTCCCGTCCTCCTCACACACTA 0: 1
1: 0
2: 1
3: 16
4: 299
Right 1031972501 7:128074748-128074770 TGCTGCTGCCTCCAGAGAACAGG 0: 1
1: 0
2: 4
3: 38
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031972496 Original CRISPR TAGTGTGTGAGGAGGACGGG AGG (reversed) Intronic
900794720 1:4700995-4701017 CAGTGTGTGGGCAGGACGGTGGG - Intronic
901810205 1:11763075-11763097 TGGTGTGTGTGGAGGACAGTGGG + Intronic
901925008 1:12560577-12560599 TGGTGAGTGAGGAGCAGGGGAGG - Intergenic
902447489 1:16476342-16476364 TACTGAGTGGGGAGGACGGGTGG + Intergenic
902467345 1:16626296-16626318 CACTGAGTGGGGAGGACGGGTGG + Intergenic
903184372 1:21620882-21620904 GTGTGTGTGAGCAGGAGGGGAGG - Intronic
904053545 1:27655690-27655712 CACTGTGTGAGGAAGAAGGGTGG + Intergenic
906674167 1:47681239-47681261 GAGTGTGTTGGGTGGACGGGTGG + Intergenic
908413978 1:63894491-63894513 TGGTGTGTGAAGATGATGGGAGG - Intronic
909501976 1:76344935-76344957 TAGTGTGTGCAGAGGAAGGCTGG - Intronic
911564785 1:99450968-99450990 TAGTGGGTGGGGAGGAAGTGGGG + Intergenic
911961578 1:104310477-104310499 TTGTGTGTGGGGCGGGCGGGGGG + Intergenic
912387228 1:109277537-109277559 TAGAGTGGGAGGAGGTGGGGTGG + Intergenic
914834992 1:151199286-151199308 TTGTCTTTGAGGAGGACGGATGG + Intronic
915488091 1:156235993-156236015 GAGTGTGTGTGGAGGAAAGGAGG + Intronic
915904008 1:159865069-159865091 TACTGAGTGGGGAGGAGGGGTGG + Intronic
918771188 1:188562523-188562545 GTGGGTGTGAGGAGGAGGGGAGG - Intergenic
919385254 1:196914627-196914649 TAGTGTGTGGTGAAGATGGGTGG + Exonic
923051915 1:230395536-230395558 AGGAGTGTGAGGAGGAGGGGAGG - Intronic
923273582 1:232378556-232378578 CAGCCTGTGAGGAGGACGGGGGG + Intergenic
923777234 1:236990566-236990588 TACTGTGTCTGGAGGAAGGGTGG - Intergenic
924037568 1:239953050-239953072 CGGTGTGTGAGGAGGCCTGGGGG - Intergenic
1064892869 10:20198146-20198168 GAGGGTGTGAGTAGGATGGGAGG + Intronic
1070129382 10:73646552-73646574 TAGAGAGTGAGGAGGAAGGTGGG + Exonic
1072634450 10:97169056-97169078 TAGGAAGTGAGGAGGAGGGGTGG - Intronic
1077434094 11:2530218-2530240 TGGTGGGTGAGGAGGACTTGGGG - Intronic
1080905535 11:36541104-36541126 TAGCAGGTGAGGAGGAAGGGTGG + Intronic
1081432961 11:42996691-42996713 GTGTGTGTGTGGAGGGCGGGGGG - Intergenic
1084085630 11:66853860-66853882 TGGTGTGTGAGGAGCTGGGGAGG - Intronic
1084587966 11:70074149-70074171 TGGTGTGGGAGTGGGACGGGTGG + Intergenic
1085150303 11:74247252-74247274 TAGTGTGTTAGGAGTAGAGGCGG - Intronic
1085310431 11:75513497-75513519 CAGTCTGTGAGGAGGAAGTGTGG - Intronic
1087250440 11:95893080-95893102 TAGTGAGTGAGGAGGATGGGTGG - Intronic
1087949062 11:104197740-104197762 TAATGTGTGGGGAGGGTGGGAGG - Intergenic
1089068403 11:115679614-115679636 TAATGAGTGAGAAGGACCGGGGG - Intergenic
1090033111 11:123224365-123224387 TTCTGTGTGAGGAGGATGAGGGG + Intergenic
1090957890 11:131529927-131529949 TAGTGTGTGAGGGGGAGAGGTGG - Intronic
1092182017 12:6452476-6452498 TAGTGTGTGTGGAGGGAGGGTGG + Intronic
1093549352 12:20389228-20389250 GTGTGTGTGAGGAGGAAAGGGGG + Intronic
1096218445 12:49811453-49811475 TAGTGGATGAGGAGGTGGGGAGG - Intronic
1096882235 12:54682604-54682626 GGGTGGGTCAGGAGGACGGGAGG - Intergenic
1096992528 12:55816990-55817012 TGGTGTGTGAGGAAGGCTGGCGG + Intronic
1098100478 12:67010900-67010922 TAGTTTGGGAGGAGGAGGAGTGG - Intergenic
1098169060 12:67727664-67727686 TTGTGTGTCAGGAAGCCGGGAGG + Intergenic
1099133664 12:78865435-78865457 TAGGGTGGGAGGAGGGCGAGAGG - Intronic
1099448940 12:82785360-82785382 TTGTGTTTGGGGGGGACGGGGGG - Intronic
1099941604 12:89195630-89195652 TTGTGGGGGAGGAGGAAGGGAGG - Intergenic
1100578394 12:95914761-95914783 TAGGGTGTGAGGAGCGGGGGTGG - Intronic
1103698325 12:122835005-122835027 TAGTGAGTTCGGAGGAGGGGTGG + Intronic
1104743641 12:131196331-131196353 TGGTGTGTGAGGATGAGAGGAGG - Intergenic
1106626476 13:31425655-31425677 GAGTGTGAGAGAAGGAGGGGAGG + Intergenic
1107715873 13:43198997-43199019 TAGCATGTGAGGAAGGCGGGAGG + Intergenic
1107808702 13:44178806-44178828 TAGTGGGGGAGCAGGACAGGAGG - Intergenic
1113026849 13:105949796-105949818 TAGTGTGTGCAGAGTAGGGGTGG + Intergenic
1114627193 14:24137292-24137314 TAGGGTGGGAGGAGGGCTGGAGG - Intronic
1114653427 14:24301016-24301038 TAGTGTGTGCGGAGGCCCAGAGG + Intronic
1115496305 14:34008032-34008054 TAGTGGGAGAGGAGGAGGAGTGG - Intronic
1115769920 14:36657916-36657938 TGGTGGGAGAGGAGGACAGGAGG - Intronic
1116143404 14:41031399-41031421 AAGAGTGTGAGGAGTAGGGGAGG - Intergenic
1116147659 14:41096232-41096254 TACTATGTGAGGAGCAGGGGAGG - Intergenic
1117231697 14:53725553-53725575 GAGTGTGGAAGGAGGACGGCGGG - Intergenic
1117294983 14:54370921-54370943 GACTGGGGGAGGAGGACGGGGGG - Intergenic
1118441744 14:65818516-65818538 TTGTGTGTGGGGAGGGTGGGGGG - Intergenic
1119157406 14:72423677-72423699 TAGGGTGGGAGGGGGACGAGGGG + Intronic
1120720169 14:87881931-87881953 TAGTGAGGGAGGAGGAAGTGGGG - Intronic
1121609612 14:95268492-95268514 TAGTGACTGAGAAGGAAGGGTGG + Intronic
1122230631 14:100304948-100304970 TAGTGGGTGGGGAGCAAGGGTGG + Intronic
1122857351 14:104566208-104566230 AAATGTGTGCGGAGGACAGGAGG - Intronic
1124139360 15:27063867-27063889 AAGTGGGTGAGCAGGCCGGGTGG - Intronic
1124563286 15:30794409-30794431 CACTGTGTGAGGAGGATGGAGGG - Intergenic
1125476307 15:40050271-40050293 GAGTGTGTGAGGTGGAAGGTGGG + Intergenic
1126645845 15:50874225-50874247 GAGTGTCTGCGGAGGGCGGGGGG - Intergenic
1126671339 15:51118091-51118113 TAGTGTGTTTGGAGGAGGAGGGG + Intergenic
1128541552 15:68538237-68538259 TGGTGTGTGTGGAGGAAGAGGGG + Intergenic
1129088328 15:73121211-73121233 ATGTGTGGGAGGAGGACAGGCGG - Intronic
1132209290 15:100008281-100008303 TACTGTGTGAGGAAGAGGAGAGG + Intronic
1133073419 16:3262009-3262031 TAGTGTTTGAGGAAGAGTGGTGG + Intergenic
1134894731 16:17874634-17874656 GAGTGTGTGAGGGAGACAGGAGG - Intergenic
1135316560 16:21451256-21451278 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1135369482 16:21883501-21883523 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1135442331 16:22487626-22487648 TAGTGAGTGAAGAGGAAGGAAGG + Intronic
1135583680 16:23650431-23650453 TGGTGTGTGGGGAGGGAGGGAGG - Intronic
1136326673 16:29531735-29531757 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1136441363 16:30271719-30271741 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1136551058 16:30982831-30982853 GAGAGGGTGAGGGGGACGGGAGG + Intronic
1138111309 16:54326376-54326398 TAGGGAGTGAGGAGGAGGGAAGG - Intergenic
1138731207 16:59197073-59197095 AAGTATGTGAGGAGTAAGGGAGG - Intergenic
1139887858 16:70224032-70224054 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1141816857 16:86416613-86416635 TAGTGTGTGACCAGGACCAGGGG + Intergenic
1142777727 17:2154324-2154346 TAGAGTGTGACGGTGACGGGGGG + Intronic
1145759557 17:27418499-27418521 TTGTGGGTGAGGTGGAGGGGAGG + Intergenic
1146832588 17:36082534-36082556 TCGTGAGAGAGGAGGACGTGAGG + Intergenic
1146847070 17:36188846-36188868 TCGTGAATGAGGAGGACGTGGGG + Intronic
1147189597 17:38730810-38730832 TCTTGTGCGAGGAGGAGGGGAGG - Intronic
1147306681 17:39569044-39569066 GGGTGTGGGAGGAGGAAGGGTGG - Intergenic
1147326084 17:39670238-39670260 CAGTGTCTGAGGAGGAGGTGAGG + Exonic
1147522230 17:41184698-41184720 TAGTCTGAGAGCAGGATGGGCGG + Exonic
1148109696 17:45137457-45137479 TAGTGCTTGAGCAGGAGGGGTGG + Intronic
1149515819 17:57280152-57280174 CAGAGAGTGAGGAGGACAGGGGG + Intronic
1149957256 17:61065676-61065698 TATTGTTTGTGGAGGAAGGGTGG + Intronic
1151042758 17:70882788-70882810 GAGTTGGTGTGGAGGACGGGAGG + Intergenic
1151104813 17:71600565-71600587 GTGTCAGTGAGGAGGACGGGTGG - Intergenic
1151145271 17:72034676-72034698 AGGTGTGTGAGGAGGTGGGGTGG - Intergenic
1151366742 17:73622528-73622550 CAGTGTTTGAGGAGGGAGGGAGG + Intronic
1154031203 18:10755904-10755926 TAGAGGGTGAGGAGGAGGGATGG + Intronic
1154031468 18:10757188-10757210 TAGAGGATGAGGAGGAGGGGTGG + Intronic
1154031523 18:10757427-10757449 TGGAGGGTGAGGAGGAAGGGTGG + Intronic
1154939499 18:21096999-21097021 AATTGTGTGAGGAGGACATGGGG + Intronic
1158275638 18:55764377-55764399 TAGTGTGTGGGGCGGAGCGGGGG - Intergenic
1158952047 18:62503893-62503915 TAGAGTGGGAGGAGGAGGGAGGG + Intergenic
1160703498 19:518722-518744 TAGAGGGTGAGGAGGAGGGGAGG + Intronic
1161195401 19:2983610-2983632 CAGAGTGAGAGGAGGAGGGGGGG + Intronic
1161392719 19:4029477-4029499 TGCTGTGGGAGGAAGACGGGCGG + Intronic
1162562790 19:11427106-11427128 CAGTGTGGGAGAAGGAAGGGAGG - Intronic
1164525303 19:29009043-29009065 GAGTGTGTGAGGAAGACAAGGGG - Intergenic
1165829586 19:38723869-38723891 CAGTATGTGAGCAGGAGGGGTGG - Intronic
1166042514 19:40212542-40212564 TAGGCTGTGAAGAGGAGGGGAGG + Intronic
1166146985 19:40844791-40844813 TTGTGTGTGATGAGGAGGGTCGG + Intronic
1166151143 19:40876687-40876709 TTGTGTGTGATGAGGAGGGTCGG + Intronic
1167449136 19:49556802-49556824 CTGTGCGTGAGGAGGACGGTGGG + Intronic
1167643089 19:50692827-50692849 TAGGGTGTGAGGAGGGCTTGTGG - Intronic
1167853494 19:52219863-52219885 TGGTGAGTGAGGAGGCCTGGGGG + Exonic
1168467265 19:56613231-56613253 TAGTCTGTGAAGAGAACTGGTGG - Intronic
926116432 2:10216484-10216506 TGGGGAGTGGGGAGGACGGGAGG + Intergenic
926706280 2:15840063-15840085 TAGTGTGTGAGGAGGGGTGAAGG - Intergenic
926791121 2:16573031-16573053 TAGTGTGTCAGGGGGCCTGGAGG - Intronic
927083046 2:19649214-19649236 TAGTATGTGAGGAGAATGAGAGG - Intergenic
928810416 2:35218083-35218105 TAGTGTCTGAGCAGGAAGGCTGG + Intergenic
929166975 2:38892367-38892389 GAGTGTGTGAGTAGGTGGGGTGG + Intronic
929558057 2:42937686-42937708 TGGTGGGGGAGGAGGGCGGGAGG - Intergenic
932702628 2:74001993-74002015 TTGTGTGTGTGGAGGAGGGCAGG + Intronic
933529927 2:83495420-83495442 TAGGGTGGGAGGAGGAGGGAGGG + Intergenic
936120920 2:109743774-109743796 TAGTAAATGAGGAGGATGGGAGG - Intergenic
936372772 2:111917046-111917068 TAGTGTTTGGGGAGGCCAGGTGG - Intronic
937290754 2:120780402-120780424 CAGTGTGAAAGGAGGAAGGGAGG + Intronic
938090244 2:128426509-128426531 TGGAGTGTGGGGAGGATGGGAGG - Intergenic
938632040 2:133177881-133177903 TGGTGTGAGAGGAGGCCTGGTGG + Intronic
938653448 2:133407463-133407485 AAGTGTGACAGGAGGACGGGTGG + Intronic
939525722 2:143291393-143291415 GAGTGAGTGAGGAGGGAGGGAGG - Intronic
940900821 2:159124859-159124881 TACTTGGTGAGGAGGGCGGGGGG - Intronic
941855101 2:170222954-170222976 TGGTGTGTGTGGAGTAGGGGAGG - Intronic
942719910 2:178939746-178939768 TTGTGTGTGTGGTGGAGGGGGGG + Intronic
944531314 2:200670308-200670330 CAGTGTGAGTGGAGGATGGGAGG - Intronic
945037571 2:205717209-205717231 TGGTGGGTGGGGAGGACTGGAGG - Intronic
947404558 2:229761339-229761361 GTGTGTGTGAGGAGTAGGGGAGG + Intergenic
948223395 2:236290807-236290829 TGGTGTATGAGGCAGACGGGGGG + Intergenic
1170756461 20:19211129-19211151 TTGTCTGGGAGGAGGTCGGGGGG + Intergenic
1174875515 20:54223031-54223053 TTGTGTGTAAGGAGTAGGGGTGG - Intronic
1175158403 20:56989956-56989978 TTGTGTGTGGGGGGGGCGGGGGG + Intergenic
1175974056 20:62701602-62701624 TGGTGTGTGAGCAGGAAGGGTGG - Intergenic
1176108384 20:63400006-63400028 CAGTGAGTGAGGAGCAGGGGCGG - Intergenic
1177829792 21:26125238-26125260 CAGTGTATGAGGAGGATGCGGGG + Intronic
1178272010 21:31199436-31199458 TGGTGTTTGAGGAGGATTGGCGG - Intronic
1178379952 21:32099496-32099518 TAGTGTCTTAGGAGGCCGTGTGG + Intergenic
1178629330 21:34245552-34245574 TCTTGTGGGAGGAGGAAGGGAGG + Intergenic
1179043997 21:37829216-37829238 GATTGTGGGAGGAGGGCGGGAGG + Intronic
1181237666 22:21457464-21457486 AAGGGTGTGAGGCGGAGGGGAGG + Intergenic
1182567905 22:31213252-31213274 TGGTGTGTGAGGTGGCGGGGAGG - Intronic
1182627274 22:31656743-31656765 GAGTGAGTGAGGAGGAAGAGAGG - Intronic
1183223926 22:36536351-36536373 TTTTGTGGGAGGAGGAGGGGAGG + Intergenic
1183466986 22:37984759-37984781 TAGTCTGGGAGGTGGAGGGGAGG + Intronic
949710192 3:6862724-6862746 TAGTGGGTGAGGGGGGCGGGGGG - Intronic
950845481 3:16011555-16011577 TTGTGTGTGGGGGGGTCGGGGGG + Intergenic
952233937 3:31459646-31459668 TAGGGTGGGAGGATGACAGGGGG + Intergenic
953780133 3:45861491-45861513 TAATGTGTGCTGAGGAGGGGTGG + Intronic
954036681 3:47854619-47854641 TACTGTGGAAGGAGGAAGGGAGG + Intronic
954228774 3:49200050-49200072 TAGTGTTTGAGGCGGGCCGGTGG + Intronic
955012386 3:55030996-55031018 TAATGTGTGGGGAAGAGGGGTGG + Intronic
955822301 3:62909009-62909031 TAGGGTGAGTGGAGGAAGGGAGG + Intergenic
958765449 3:98361579-98361601 GAGTGTGTGTGGAGGAGGGGTGG + Intergenic
958828189 3:99057598-99057620 TGGTGTGTGGTGAGGACAGGGGG - Intergenic
961197408 3:125014512-125014534 GAGTGTGTGTGGAGGGCTGGGGG + Intronic
962216569 3:133527550-133527572 TAGTGTGTGAGGATAAGGTGAGG - Intergenic
962311876 3:134332568-134332590 TAGGGGGAGAGGAGGTCGGGCGG - Intergenic
964404563 3:156335417-156335439 TAGTATGTGAGGAGTAATGGAGG - Intronic
965714497 3:171588079-171588101 TTTGGTGTGAGGAGGACAGGGGG - Intergenic
968009424 3:195264019-195264041 TAGTGTGCAAGGAGGAGAGGAGG - Intronic
968930015 4:3573733-3573755 AGGGGTGTGAGGCGGACGGGAGG + Intergenic
968968499 4:3781523-3781545 TCGTGTGGGAGGAAGACGTGGGG - Intergenic
975382038 4:73711800-73711822 TAGTGTGTGTGTAGGAAGGAGGG + Intergenic
975519493 4:75284588-75284610 TAGTGTTTGATGGGGATGGGAGG - Intergenic
975661117 4:76689701-76689723 TGGTGAGTGAGGAGGGCGGCTGG + Intronic
976327683 4:83791390-83791412 AAGTATGTGAAGAGCACGGGTGG - Intergenic
980027073 4:127780698-127780720 AGGTGTGTGAGGAGAACTGGTGG + Intergenic
980400885 4:132284514-132284536 TAGTGAGAGAGGAGGAAGGAAGG + Intergenic
981001539 4:139833486-139833508 TAGAGTGGGAGGAAGAAGGGGGG + Intronic
981178417 4:141709918-141709940 TAGTGTGGGGGGAGGGTGGGAGG - Intronic
982010278 4:151099461-151099483 TCGTGTGTGGGGAGGCCGCGCGG - Intergenic
983209649 4:164945743-164945765 TGGTGAGTGAGGAGAACGTGAGG - Intergenic
985732148 5:1555325-1555347 TCGTGTGTGAGGAGGGCGCCCGG - Intergenic
986415153 5:7520818-7520840 TGGTGTGGGAGGAGGAGGTGAGG - Exonic
986987008 5:13511687-13511709 TAGTGTGCCAGGAAGACAGGTGG + Intergenic
990524557 5:56612042-56612064 AAGTGGGTGAGGAGGAGGTGGGG + Intergenic
992131503 5:73697594-73697616 TATTGTGGGAGGGGGACTGGTGG - Intronic
993116185 5:83722332-83722354 TAGTGGGGCAGGAGGATGGGCGG + Intergenic
996436382 5:123437410-123437432 TAGAGTGTGGGGAGGAGAGGAGG - Intergenic
997883415 5:137610839-137610861 TAGTGAATGAGGAGAACGTGTGG - Intergenic
998616063 5:143741852-143741874 TGCTGTGTGAGTAGGAGGGGTGG + Intergenic
999188218 5:149728582-149728604 TAGGGTGGGAGGAGGGCAGGAGG + Intergenic
1001773220 5:174311295-174311317 CTGTGTGTGAGGAGGCCCGGGGG + Intergenic
1003147816 6:3523541-3523563 CAGAGTCTGAGGAGGAAGGGAGG - Intergenic
1003873453 6:10418731-10418753 TGGTGGGTGAGGAGGCAGGGGGG - Intronic
1004980906 6:21022599-21022621 TTGTGTGTGAGGAGGGAAGGGGG + Intronic
1005852493 6:29832011-29832033 TGGTGTGGGAGGAGGGAGGGAGG + Intergenic
1005859829 6:29891673-29891695 TGGTGTGGGAGGAGGTAGGGAGG + Intergenic
1007845734 6:44754283-44754305 TGGTGTGGGGGGAGGAGGGGAGG + Intergenic
1009900168 6:69800098-69800120 TTGTGGGTGAGGTGGAGGGGTGG - Intergenic
1013025890 6:106271187-106271209 TAGTGACTGAGGAGGAAGTGTGG - Intronic
1018103263 6:160459964-160459986 TAGGGTGTGAGGATGTGGGGTGG + Intergenic
1018137645 6:160793011-160793033 ATGTGTGTGGGGAGGACGGATGG - Intergenic
1018818656 6:167355942-167355964 TACAGTGTGAGGAGGACCCGAGG + Intronic
1020418149 7:7969235-7969257 GAGTGTGTAAGGGGGAGGGGCGG - Exonic
1021121737 7:16803234-16803256 TTGTGAGTGAGGAGGGAGGGAGG + Intronic
1023518854 7:41030816-41030838 TGGTGAGTGAGGAGAAAGGGAGG + Intergenic
1027266830 7:76499139-76499161 TAGGGTGTGAGGAGGTGTGGAGG + Intronic
1027318217 7:76997279-76997301 TAGGGTGTGAGGAGGTGTGGAGG + Intergenic
1030496569 7:110308018-110308040 GAGTGTGTGAGGAGGGAGGCTGG + Intergenic
1030927538 7:115477062-115477084 TAGTGTGTGGGGGGGTGGGGTGG + Intergenic
1031028805 7:116712689-116712711 GTGTGTGTGGGGGGGACGGGAGG - Intronic
1031513697 7:122677434-122677456 AGGTGCCTGAGGAGGACGGGTGG + Intronic
1031638296 7:124129343-124129365 TTGTGTGTGGGGAGGAGGGGAGG - Intergenic
1031972496 7:128074724-128074746 TAGTGTGTGAGGAGGACGGGAGG - Intronic
1034896183 7:154877879-154877901 CAGTGTGGAAGGAGGATGGGTGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035726046 8:1824981-1825003 TGGGGTGTGGGGAGGACAGGTGG - Intronic
1036484184 8:9164699-9164721 GAGAGTGTGATCAGGACGGGGGG + Intronic
1037821772 8:22138614-22138636 CAGTGTGGGAGGACGACAGGAGG - Intronic
1038528208 8:28295379-28295401 GGGTGTGTGAGCAGGACGAGGGG + Intergenic
1045373531 8:101549135-101549157 TAGTGTGGGGGTAGGAGGGGTGG + Intronic
1046547063 8:115667173-115667195 TAGAGGGTGAGAAGGACTGGTGG - Intronic
1048385948 8:133912693-133912715 TTGTGAGAGAGGAGCACGGGTGG - Intergenic
1048823640 8:138402021-138402043 GTGTGTGTGAGGAGGGTGGGAGG + Intronic
1051107659 9:13598138-13598160 TAGTGTGTGAATAGAATGGGAGG + Intergenic
1052903924 9:33817567-33817589 TCGTGTGTGAGGAGGACCCCGGG + Exonic
1053666421 9:40321035-40321057 TAGGGTGGTAGGAGGATGGGGGG + Intronic
1054518188 9:66055248-66055270 TAGGGTGGTAGGAGGATGGGGGG - Intergenic
1055650451 9:78401923-78401945 TAGAGTGTGAGGAGGATGAGGGG - Intergenic
1059643639 9:116242153-116242175 TATGGTGTGAGGAGCACGGGGGG + Intronic
1060725338 9:126002508-126002530 TGGTGTGTATGGAGGAAGGGTGG + Intergenic
1061488736 9:130933789-130933811 TAGGAAGTGAGGAGGAAGGGAGG - Intronic
1061599974 9:131662134-131662156 CAGTGTGTGAGCAGGCCGGGTGG - Intronic
1061906941 9:133703765-133703787 TTGTGTGTGAAGAGGAGGTGAGG - Intronic
1062129658 9:134885619-134885641 GAGTCTGTGAGGAGAACAGGTGG + Intronic
1062382280 9:136292205-136292227 TGGTGCCTGCGGAGGACGGGAGG + Exonic
1185821627 X:3210452-3210474 CAGTGTGTGAGGTGGACTGTGGG - Intergenic
1186053715 X:5626999-5627021 TAGTGTCTCAGGGGGAGGGGAGG + Intergenic
1186137035 X:6532819-6532841 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137058 X:6532882-6532904 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137079 X:6532941-6532963 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186137098 X:6533000-6533022 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186137108 X:6533033-6533055 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137131 X:6533096-6533118 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137166 X:6533192-6533214 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137200 X:6533285-6533307 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137210 X:6533314-6533336 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186137220 X:6533347-6533369 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137242 X:6533409-6533431 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137265 X:6533472-6533494 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137277 X:6533505-6533527 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137289 X:6533538-6533560 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186267153 X:7844201-7844223 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267165 X:7844234-7844256 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267187 X:7844296-7844318 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267197 X:7844325-7844347 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267209 X:7844358-7844380 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267232 X:7844421-7844443 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186297754 X:8169208-8169230 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297766 X:8169241-8169263 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297778 X:8169274-8169296 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297790 X:8169307-8169329 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297802 X:8169340-8169362 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297814 X:8169373-8169395 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297826 X:8169406-8169428 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297838 X:8169439-8169461 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297848 X:8169468-8169490 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297860 X:8169501-8169523 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297872 X:8169534-8169556 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297884 X:8169567-8169589 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297894 X:8169596-8169618 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297906 X:8169629-8169651 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297916 X:8169658-8169680 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297928 X:8169691-8169713 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297942 X:8169728-8169750 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297954 X:8169761-8169783 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297966 X:8169794-8169816 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297980 X:8169831-8169853 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186324860 X:8466568-8466590 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324894 X:8466663-8466685 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324904 X:8466692-8466714 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324953 X:8466834-8466856 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324999 X:8466960-8466982 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325012 X:8466993-8467015 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325024 X:8467026-8467048 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325056 X:8467117-8467139 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325066 X:8467146-8467168 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325095 X:8467234-8467256 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325105 X:8467263-8467285 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1187255011 X:17634709-17634731 TGGTGTGTGTTGAGGGCGGGTGG + Intronic
1193893343 X:87079735-87079757 TAGGGTGGGAGGAGGGGGGGAGG - Intergenic
1195284360 X:103369135-103369157 TAGTGAGGGAGGAGGAAGAGAGG + Intergenic
1195910052 X:109880379-109880401 TAGAGTGTGAGGTGGGAGGGAGG - Intergenic
1197334396 X:125194263-125194285 TAGGGTGTGAGGAAGAAGGAGGG - Intergenic
1198840729 X:140854638-140854660 TAGTTAGTGAGGAGGCAGGGAGG - Intergenic
1200073006 X:153538206-153538228 TTGTGTCTGAGGAGGACTGAGGG - Intronic
1201294213 Y:12449899-12449921 TAGTGTGTGGGGAAGGCTGGTGG - Intergenic
1201438636 Y:13985609-13985631 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201438657 Y:13985667-13985689 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201445916 Y:14057041-14057063 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201445937 Y:14057099-14057121 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic