ID: 1031972502

View in Genome Browser
Species Human (GRCh38)
Location 7:128074751-128074773
Sequence TGCTGCCTCCAGAGAACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 265}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031972494_1031972502 9 Left 1031972494 7:128074719-128074741 CCTGCCCTCCCGTCCTCCTCACA 0: 1
1: 0
2: 5
3: 50
4: 744
Right 1031972502 7:128074751-128074773 TGCTGCCTCCAGAGAACAGGAGG 0: 1
1: 0
2: 2
3: 35
4: 265
1031972498_1031972502 0 Left 1031972498 7:128074728-128074750 CCGTCCTCCTCACACACTAATGC 0: 1
1: 1
2: 0
3: 24
4: 282
Right 1031972502 7:128074751-128074773 TGCTGCCTCCAGAGAACAGGAGG 0: 1
1: 0
2: 2
3: 35
4: 265
1031972495_1031972502 5 Left 1031972495 7:128074723-128074745 CCCTCCCGTCCTCCTCACACACT 0: 1
1: 0
2: 2
3: 54
4: 606
Right 1031972502 7:128074751-128074773 TGCTGCCTCCAGAGAACAGGAGG 0: 1
1: 0
2: 2
3: 35
4: 265
1031972496_1031972502 4 Left 1031972496 7:128074724-128074746 CCTCCCGTCCTCCTCACACACTA 0: 1
1: 0
2: 1
3: 16
4: 299
Right 1031972502 7:128074751-128074773 TGCTGCCTCCAGAGAACAGGAGG 0: 1
1: 0
2: 2
3: 35
4: 265
1031972497_1031972502 1 Left 1031972497 7:128074727-128074749 CCCGTCCTCCTCACACACTAATG 0: 1
1: 0
2: 0
3: 11
4: 201
Right 1031972502 7:128074751-128074773 TGCTGCCTCCAGAGAACAGGAGG 0: 1
1: 0
2: 2
3: 35
4: 265
1031972499_1031972502 -4 Left 1031972499 7:128074732-128074754 CCTCCTCACACACTAATGCTGCT 0: 1
1: 0
2: 1
3: 19
4: 201
Right 1031972502 7:128074751-128074773 TGCTGCCTCCAGAGAACAGGAGG 0: 1
1: 0
2: 2
3: 35
4: 265
1031972493_1031972502 10 Left 1031972493 7:128074718-128074740 CCCTGCCCTCCCGTCCTCCTCAC 0: 1
1: 0
2: 13
3: 102
4: 1144
Right 1031972502 7:128074751-128074773 TGCTGCCTCCAGAGAACAGGAGG 0: 1
1: 0
2: 2
3: 35
4: 265
1031972491_1031972502 24 Left 1031972491 7:128074704-128074726 CCCAGCTGTGCTCTCCCTGCCCT 0: 1
1: 1
2: 6
3: 68
4: 612
Right 1031972502 7:128074751-128074773 TGCTGCCTCCAGAGAACAGGAGG 0: 1
1: 0
2: 2
3: 35
4: 265
1031972500_1031972502 -7 Left 1031972500 7:128074735-128074757 CCTCACACACTAATGCTGCTGCC 0: 1
1: 0
2: 0
3: 14
4: 200
Right 1031972502 7:128074751-128074773 TGCTGCCTCCAGAGAACAGGAGG 0: 1
1: 0
2: 2
3: 35
4: 265
1031972492_1031972502 23 Left 1031972492 7:128074705-128074727 CCAGCTGTGCTCTCCCTGCCCTC 0: 1
1: 0
2: 11
3: 84
4: 709
Right 1031972502 7:128074751-128074773 TGCTGCCTCCAGAGAACAGGAGG 0: 1
1: 0
2: 2
3: 35
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031972502 Original CRISPR TGCTGCCTCCAGAGAACAGG AGG Intronic
902389431 1:16094525-16094547 TGCGGCCTCCTGGGAACAGCTGG - Intergenic
903180682 1:21603423-21603445 TCCTGCCTCCAGAGAAGCTGGGG - Intronic
905283546 1:36864599-36864621 TGCTGCCTCTGGAGACCAGAAGG - Intronic
905484156 1:38283996-38284018 GGCTGCCCCAAGAGAAGAGGTGG + Intergenic
907045806 1:51299431-51299453 CGCTGCCTGCACAGAGCAGGTGG + Intronic
907704877 1:56824326-56824348 TGCATCCTCCAGAGAACAGAAGG + Intergenic
908118338 1:60962785-60962807 TGATGCCTCCACAGAAGAGGAGG + Intronic
910046398 1:82922772-82922794 TACTGCCTCCAGCATACAGGTGG - Intergenic
910278088 1:85469226-85469248 GTCTGCCTCCAGAGAACAGTGGG + Intronic
910666252 1:89728521-89728543 TTCTGTCTCCAGAGGAAAGGTGG + Intronic
910936103 1:92485444-92485466 TGGCGCCACCAGAGACCAGGCGG + Intronic
912691755 1:111809962-111809984 TGCTGCCTTTAGAGCCCAGGAGG - Intronic
915311824 1:155008936-155008958 TGCTGCCCCCAGGGGCCAGGAGG + Intronic
915326761 1:155084813-155084835 GCCTGCCTCCAAAGAAAAGGAGG - Intronic
915557483 1:156668626-156668648 GGCTGCCTCCTGAGGAGAGGAGG - Intergenic
916648888 1:166816765-166816787 TGCTGCCGGTAGAGAAGAGGTGG + Intergenic
918075597 1:181168823-181168845 TGCTCCTTCCAGAGTACAGAGGG - Intergenic
920068045 1:203282962-203282984 TCCTCCCTCCAGAGAGCAGAGGG + Intergenic
920848921 1:209615481-209615503 TGCTACCTCCAGTTAGCAGGAGG - Intronic
921478822 1:215640313-215640335 CGCTGCCTCCACAGGACTGGAGG - Intronic
922546661 1:226463103-226463125 TGTTGCCCCCAGGGAACAGGTGG - Intergenic
923527102 1:234780889-234780911 TGCCGCCTCTAGAGAAAACGTGG - Intergenic
1062761788 10:28107-28129 TGCTGGCACCAGGGACCAGGAGG + Intergenic
1062952774 10:1517061-1517083 TCCTCCCTCCAGTGAGCAGGCGG - Intronic
1065188570 10:23191811-23191833 TGCTGCCCTCAGGGACCAGGTGG - Intergenic
1065383001 10:25108757-25108779 TGAAGCCTCCAGAGAATAGATGG - Intergenic
1065834060 10:29640960-29640982 TGCTGCCTCCAACAGACAGGTGG + Intronic
1066065800 10:31760052-31760074 TGCTTCCTCCCGAGCGCAGGAGG - Intergenic
1067067485 10:43112121-43112143 TGCTGACTGCACAGGACAGGGGG - Exonic
1067877731 10:50020009-50020031 TGCGGCCTCCATGGGACAGGTGG - Intergenic
1068601613 10:58963123-58963145 TTTTGTCCCCAGAGAACAGGTGG + Intergenic
1073130116 10:101182914-101182936 TCCTGCCTCCACAGAACCAGAGG - Intergenic
1074451531 10:113563638-113563660 TGCTGCCTACAGCCAGCAGGTGG - Intronic
1074722937 10:116278926-116278948 TGCTGCCTCCAGAGAGAGAGAGG - Intergenic
1076299687 10:129415571-129415593 TCCTGCTTCCAGTGACCAGGAGG - Intergenic
1076507956 10:130990661-130990683 AGCTGGCACCAGAAAACAGGTGG - Intergenic
1076635870 10:131881521-131881543 TCCTGTCTCCAAAGAAAAGGAGG - Intergenic
1076832221 10:133001391-133001413 TGCTCTCTGCAGATAACAGGTGG + Intergenic
1077107473 11:848375-848397 GGGGGCCCCCAGAGAACAGGAGG - Intronic
1078162960 11:8857685-8857707 TGCTGCCTTCAGAATCCAGGAGG - Intronic
1078885780 11:15498434-15498456 TGCTGCCTCTTGAGCACAGAGGG - Intergenic
1081746651 11:45477817-45477839 TGCTTCATCCAGAGAAAATGTGG + Intergenic
1081951017 11:47043072-47043094 TTCTGAATCCAGAGCACAGGAGG - Intronic
1081957694 11:47107858-47107880 TGCTGCCCCAAGGGAACTGGGGG - Intronic
1082848478 11:57744787-57744809 TGCTGCCACCAGTGAGCTGGAGG - Exonic
1083304714 11:61756336-61756358 CTCTGCCTCCAGAGGGCAGGAGG + Intronic
1084065440 11:66701274-66701296 TGCTGCCACCTGAGAGCAGGGGG + Exonic
1084356367 11:68641397-68641419 TGCTGTCACCTGAGAGCAGGCGG + Intergenic
1084518884 11:69650879-69650901 TTGTGGCTCCAGAGACCAGGTGG + Intronic
1085527549 11:77173032-77173054 TGCTGCCTCCAATAAATAGGGGG - Intronic
1089223134 11:116892277-116892299 AGGTGCTTCCAGAGGACAGGAGG + Intronic
1091311289 11:134576973-134576995 AGCTTCCTCCAGGGAACAGGAGG - Intergenic
1091417838 12:305537-305559 GGCTGCTTCCAGAGAACAAGGGG - Intronic
1092475355 12:8814276-8814298 TTCTACCTCCAGAGAGCATGGGG - Intergenic
1093002248 12:14010439-14010461 TGATGTCTCCAGAGAAAAGGAGG + Intergenic
1096602729 12:52742016-52742038 TGCTTTCTCCTTAGAACAGGAGG - Intergenic
1098010407 12:66044823-66044845 TGCTGCCACCAGAGTACCGCTGG + Intergenic
1099466610 12:82995758-82995780 TACTGCTTTCAGAAAACAGGAGG - Intronic
1103523161 12:121549628-121549650 TTCTGCCTCCAGGGAGCCGGCGG - Exonic
1104188772 12:126457981-126458003 TGCGGCCTGCAGGGAACAGGTGG + Intergenic
1104761129 12:131298248-131298270 TGCTGTGTTCAGACAACAGGAGG + Intergenic
1104818647 12:131662544-131662566 TGCTGTGTTCAGACAACAGGAGG - Intergenic
1105831640 13:24167445-24167467 TGCTGCCAACAGAGAACACGGGG + Intronic
1105932305 13:25063980-25064002 TCCTGTCTCCAAAGAAAAGGAGG - Intergenic
1106571878 13:30934779-30934801 TGCTTGCTCCATAGAGCAGGAGG - Intronic
1108455504 13:50609683-50609705 TCCTTTCTCCAGAGAACATGGGG - Intronic
1109168882 13:59071544-59071566 TGCTGCATGAAGTGAACAGGAGG + Intergenic
1110102858 13:71631761-71631783 TCATCCATCCAGAGAACAGGGGG + Intronic
1112169797 13:96959163-96959185 TGCTTCCTCCAGAGGACTGGGGG + Intergenic
1112173085 13:96994117-96994139 TGCTGCCTCCAGAGAAGAAGGGG + Intronic
1114693829 14:24608532-24608554 TACTGCCTGCAGAGCTCAGGAGG - Intronic
1117475884 14:56094763-56094785 TGCTGACTTCAGAGAGAAGGGGG - Intergenic
1119985668 14:79134207-79134229 TTCTGCCTGCTGAGAATAGGTGG - Intronic
1120917282 14:89721190-89721212 TGCTGGCTCCATAAGACAGGGGG - Intergenic
1121675443 14:95748728-95748750 TGCTGTTTCCACAGCACAGGAGG + Intergenic
1121829540 14:97038068-97038090 TATTGTGTCCAGAGAACAGGAGG + Intergenic
1122021888 14:98844851-98844873 TGCTGCCTCCAGACCCAAGGGGG + Intergenic
1202852827 14_GL000225v1_random:31604-31626 TGCTGCTCCCACAGCACAGGCGG - Intergenic
1124076539 15:26450870-26450892 TGCTATCTCCAAGGAACAGGAGG - Intergenic
1124374608 15:29122223-29122245 TGATGCCACCAGAAAACAAGGGG + Exonic
1125691387 15:41598955-41598977 TCCTGCCTCCAGCCAAGAGGTGG + Intergenic
1126822676 15:52520299-52520321 TGCTCACCCCAGAGACCAGGGGG - Intronic
1127676208 15:61241785-61241807 CACTGCCTCCAGAGAAGATGTGG + Intergenic
1127819625 15:62643687-62643709 TGCTGCCTTCAGAGAGCAGGAGG - Intronic
1128633944 15:69291072-69291094 TGCTGACTCCAGGGAGGAGGGGG - Intergenic
1129088194 15:73119613-73119635 TGCTGCCTCTGGAGAACTGCAGG - Intronic
1130011875 15:80158550-80158572 AGCTGCTTCCACAGAACTGGAGG - Intronic
1130032503 15:80328576-80328598 TGCTCTCTCCAGAGAAGAGAGGG - Intergenic
1130162046 15:81411352-81411374 TGCTGGGGCCAGAGCACAGGGGG + Intergenic
1130650970 15:85762034-85762056 AGCAGCCTTCAGAGAACAGACGG - Intronic
1132021181 15:98364007-98364029 TGCTGACCCCAGAGAGCTGGAGG - Intergenic
1132225583 15:100138581-100138603 TGCAGCCTGCAGAGGAAAGGCGG + Intronic
1134444544 16:14320909-14320931 AACATCCTCCAGAGAACAGGAGG - Intergenic
1136686940 16:32000953-32000975 TGGTGGCTCCAGAAAGCAGGAGG + Intergenic
1136787549 16:32944502-32944524 TGGTGGCTCCAGAGAGCAGGAGG + Intergenic
1136882229 16:33909284-33909306 TGGTGGCTCCAGAGAGCAGGAGG - Intergenic
1137825789 16:51493739-51493761 TGCTGGCCCCACACAACAGGTGG + Intergenic
1138493337 16:57391168-57391190 TGCTGCCTCCTGAGCACTCGAGG + Intergenic
1141282450 16:82641154-82641176 TGGTCCCTCCACAGAATAGGTGG + Intronic
1141920280 16:87131063-87131085 GGCTGCCCCCAGGGCACAGGGGG - Intronic
1142338414 16:89505495-89505517 GACTGCCTCTAGAGAATAGGCGG + Intronic
1203089781 16_KI270728v1_random:1206162-1206184 TGGTGGCTCCAGAGAGCAGGAGG + Intergenic
1144479997 17:15621399-15621421 GGCTGCCTCCTGAGAATAGAGGG + Intronic
1144586286 17:16489824-16489846 TGCTGCTTTCACAGAAAAGGGGG + Intronic
1144918304 17:18742347-18742369 GGCTGCCTCCTGAGAATAGAGGG - Intergenic
1145116311 17:20213704-20213726 TGCTGCCAGAAGAGAACAGCAGG + Intronic
1146559360 17:33854886-33854908 TGCTGTCTCCAGAGCTCAGGGGG + Intronic
1147036537 17:37685803-37685825 TGCTGACTCCAGAAGAAAGGAGG - Intergenic
1147038107 17:37696859-37696881 TGCTGCCTCCTGACAGCAGAAGG - Intronic
1147147904 17:38496634-38496656 TGGTGGCTCCAGAGAGCAGGAGG + Intronic
1147869693 17:43578670-43578692 TGCTGCATTCAGAGCAAAGGTGG + Intronic
1148236421 17:45972145-45972167 GGCTGCCTCCAGAGCACACACGG - Intronic
1150294620 17:64001287-64001309 TCCTGCCTCCAGGGAAAGGGAGG + Exonic
1150639570 17:66940296-66940318 TGCTGCACCCAGGGGACAGGAGG + Intergenic
1151373146 17:73662938-73662960 TTCTTCCTCCTGAGAACAGGGGG + Intergenic
1151449998 17:74192861-74192883 TGCAGAATCCAGAGAGCAGGTGG - Intergenic
1151927389 17:77208593-77208615 TCCGGCCACCAGAGAGCAGGAGG - Intronic
1152033118 17:77855877-77855899 TGATGCTTCCAGAGAAGAAGTGG - Intergenic
1152086747 17:78224524-78224546 TGCTGCCTCCAAAGAAAGCGGGG - Exonic
1152234822 17:79133102-79133124 TTCTGCCTCCAGGGAGGAGGGGG + Intronic
1152469557 17:80483159-80483181 TTCTGCCTGCAGAGAAGGGGTGG + Intergenic
1152954695 18:28437-28459 TGCTGGCACCAGGGACCAGGAGG + Intergenic
1153531631 18:6052504-6052526 TGCTGGCTACAGTGAACAGTGGG + Intronic
1155933621 18:31731760-31731782 TGCTGCCTGGAGGGAGCAGGAGG + Intergenic
1157105837 18:44773452-44773474 AGCTGACTCCAGAGAACTGTGGG + Intronic
1159003224 18:62991467-62991489 TGCTGGCTCAAAAGAAAAGGTGG - Intergenic
1159884947 18:73894952-73894974 TGCGGCCTGCATTGAACAGGGGG + Intergenic
1160426737 18:78783093-78783115 TTCTGCCACCAGAGAGGAGGAGG + Intergenic
1160517912 18:79488642-79488664 TGCAGCCTCCTGAGCACAGATGG + Intronic
1161017398 19:1990071-1990093 AGGTGACGCCAGAGAACAGGCGG - Exonic
1161943531 19:7420203-7420225 TGCAGCCTCCTAAGTACAGGTGG + Intronic
1162035397 19:7935684-7935706 AGCTACCTCCTGAGAACAGGAGG + Intronic
1162041767 19:7975159-7975181 TGCTGTCCCCAGAGAAAAAGAGG + Intronic
1163157068 19:15445432-15445454 TGCTCCATCCAGAGAAGTGGCGG + Intronic
1163633538 19:18428551-18428573 TGCTGCCCCATGACAACAGGAGG - Intronic
1164523682 19:28998172-28998194 TCCTGTCTCCAAAGAAAAGGAGG - Intergenic
1165300070 19:34963257-34963279 TGCTGGAACCAGAGAGCAGGTGG - Intronic
1166644663 19:44522709-44522731 TGCTGTGTCCAGAGAACATGAGG - Exonic
1167289029 19:48614602-48614624 TGCTTCCTCCAGACCACAGCAGG + Intronic
1167485117 19:49758247-49758269 AGCTGCATCCAGAGAGAAGGCGG - Intronic
1168291512 19:55359808-55359830 TGCTGCCCCCAGAGTCCATGAGG + Exonic
925460955 2:4062032-4062054 TGCTGCCACCAGGGAACACAAGG + Intergenic
925686210 2:6476453-6476475 TTCTGCCTGCAGGGCACAGGGGG - Intergenic
926471594 2:13266390-13266412 TGCTTTCTTCAGAGAACAGTTGG - Intergenic
927946206 2:27136810-27136832 TGCTGAGTCCACAGAATAGGTGG - Intergenic
928393578 2:30927539-30927561 TGGTTCATCCAGAGTACAGGTGG + Intronic
930715452 2:54589725-54589747 TGCTGCCTCAAGATAACAGTTGG + Intronic
932380566 2:71277837-71277859 TGCTCCATCCAGAGGACCGGAGG - Intronic
935224682 2:101043212-101043234 AGCTGCCTCCAGAGAGGAGCTGG + Intronic
935247818 2:101234504-101234526 TCCTGTCTCCAAAGAAAAGGAGG - Intronic
936291389 2:111226593-111226615 TGCTGCCTCCAGGGCAGACGGGG - Intergenic
936993101 2:118386795-118386817 TGCTGCCGCCAGAGAATTAGAGG + Intergenic
937639960 2:124200943-124200965 GGCTGCCTCCAGAGGACATATGG - Intronic
940895498 2:159078720-159078742 TGCTGCTTCCAGAAATCAGAAGG - Intronic
941026258 2:160459651-160459673 TATTGCCTCCAGTGACCAGGAGG + Intronic
941750128 2:169126648-169126670 TGCTGCCTCTATAAAATAGGGGG - Intergenic
944206662 2:197164420-197164442 GGCCGCCCCCAGAGAACAGAGGG - Intronic
946541444 2:220688527-220688549 TGCTGCCTGCAGACAATTGGGGG + Intergenic
946551194 2:220803741-220803763 TGCTGTCTCTACAGAATAGGAGG + Intergenic
947840069 2:233202137-233202159 GGCTGACTTCAGAGAACTGGGGG - Intronic
1169243618 20:4006886-4006908 TCCTACCTCCAAAGCACAGGAGG + Intronic
1169704717 20:8489629-8489651 AACTGCCTCCAGAAATCAGGAGG + Intronic
1170329340 20:15191202-15191224 TTGTCCCTACAGAGAACAGGAGG + Intronic
1170510580 20:17072346-17072368 TGCTGGCTACAGATCACAGGTGG + Intergenic
1170757052 20:19213430-19213452 TTCTCCATCCAGAGAGCAGGCGG + Intronic
1171400555 20:24870843-24870865 TGAGGGCTGCAGAGAACAGGTGG - Intergenic
1171816768 20:29792638-29792660 TGCTGGCACCAGGGACCAGGAGG + Intergenic
1172676557 20:36676911-36676933 TGCTTGCTCCATAGAGCAGGAGG - Intronic
1174075302 20:47931230-47931252 TGCTGCAACCAGAGAAAGGGAGG + Intergenic
1174091482 20:48052166-48052188 GGCTCCATCCAGAGAGCAGGAGG - Intergenic
1174125187 20:48299134-48299156 AGCTCCATCCAGAGAGCAGGAGG + Intergenic
1175261355 20:57676076-57676098 TGCTGCCTTCGCAGAACAGTTGG - Intronic
1175764741 20:61584543-61584565 TGCTGTCTCCAGTGGACAGCAGG + Intronic
1176426171 21:6549811-6549833 AGCTGCATTCAGAGCACAGGTGG + Intergenic
1176911715 21:14573462-14573484 TGATGCATCCAGAGACCATGAGG + Intronic
1178581619 21:33843251-33843273 TCCTGCCTCCACAGAACTGGTGG + Intronic
1179701662 21:43158128-43158150 AGCTGCATTCAGAGCACAGGTGG + Intergenic
1180320237 22:11313246-11313268 TGCTGGCACCAGGGACCAGGAGG + Intergenic
1181164523 22:20976288-20976310 TGCTGGCACCAGGGAGCAGGTGG + Exonic
1182270472 22:29150163-29150185 TGGTGGCTCCAGACAACAGCTGG - Intronic
1182464498 22:30505898-30505920 TCCTGCCACCTGCGAACAGGCGG - Intergenic
1183428206 22:37750854-37750876 GGTTGCCTGCAGAGAACGGGTGG - Intronic
1184211863 22:43040796-43040818 TGCTGCCTCCTTAGCACACGCGG - Intronic
1185260175 22:49857141-49857163 TGCTCCCTGCAGCAAACAGGTGG - Intronic
1185404870 22:50642079-50642101 AGCGGCCTCCAGAGCCCAGGGGG - Intergenic
949256673 3:2055790-2055812 TGCTGCCTGGAGAGCACAGGTGG + Intergenic
949592344 3:5507678-5507700 TCCTGTCTCCAAAGAAAAGGAGG - Intergenic
950027303 3:9829025-9829047 TGCTTCCGCCAGACAACATGTGG + Exonic
950312420 3:11970158-11970180 TGCTGCCTCCAGCGAGCAAGAGG + Intergenic
952126807 3:30310361-30310383 TGCTGGCTTCAGAAAAGAGGTGG - Intergenic
952337875 3:32420723-32420745 TGCAGCGGCCAGAGAGCAGGTGG + Intronic
953361945 3:42305097-42305119 GGCTGCCTCCTCTGAACAGGTGG + Intergenic
954293030 3:49659781-49659803 TGGTGGCTCCAGAGAACAGCAGG + Intronic
954329398 3:49881490-49881512 AGCTGCCTCCTGAGAACACAAGG - Intergenic
958020663 3:87991218-87991240 TGGTGCCTCCAGAATAGAGGAGG - Exonic
961192633 3:124974929-124974951 TGCTGGCTCCTGAGAAGAGAAGG - Intronic
961452478 3:127008660-127008682 TGCCCCCTCCAGCCAACAGGCGG - Intronic
965038713 3:163478480-163478502 TGCTGCAGCTAGAGCACAGGGGG + Intergenic
966044113 3:175529320-175529342 TGCTGCCACCAGAAAACACAAGG - Intronic
966124735 3:176562670-176562692 TGCTGCCTTCTGAGAACAAAAGG - Intergenic
966224698 3:177585491-177585513 TGCTTCCTCCAGGGGAAAGGAGG - Intergenic
966936282 3:184711795-184711817 TGCAGACACCAGAGAGCAGGGGG - Exonic
967440594 3:189503329-189503351 TGCTGCCTGCAGTGAGCTGGAGG + Intergenic
968359025 3:198133701-198133723 TGCTGGCACCAGGGACCAGGAGG - Intergenic
968555333 4:1244064-1244086 TGATGCCTCCAGAGAACCTGGGG - Intronic
971082087 4:23224812-23224834 TCCTGCCTCCAAAGACCAGAAGG - Intergenic
976380485 4:84393100-84393122 CACTGCCTCCAGAGAGGAGGAGG + Intergenic
976689748 4:87856032-87856054 TGGTGCCACCAGAGACCATGTGG + Intergenic
977866812 4:102038552-102038574 TGCTGCCTCCTGCTAACAGGAGG + Intronic
980179403 4:129385813-129385835 TGCTGCTGCTATAGAACAGGTGG - Intergenic
981337335 4:143581883-143581905 TGCTGCCCCCAGAGAAGAAAAGG + Intronic
983708881 4:170690275-170690297 TCCTGTCTCCAAAGAAAAGGAGG + Intergenic
985264169 4:188142978-188143000 AGCTCCCTGCACAGAACAGGAGG - Intronic
985806950 5:2052865-2052887 TGCTGCCCCCAGAGGACCGGAGG - Intergenic
986974059 5:13374985-13375007 TGCTGGTCCCAGAGAAGAGGAGG + Intergenic
987890076 5:23864849-23864871 CGCTGTCTCCAAAGAAAAGGAGG + Intergenic
988148405 5:27342146-27342168 TTCTGACTCCAGAGACCAAGAGG + Intergenic
991507502 5:67340550-67340572 TGCTGCCTCAAGACAACATGTGG + Intergenic
992395769 5:76368317-76368339 TGGTGCATCCAGAGAAAAGTTGG - Intergenic
992881821 5:81117952-81117974 TGCTGCCTCCTGAGTACACTGGG + Intronic
992886815 5:81167691-81167713 GGCTGCCTCCAGGGCACATGAGG + Intronic
995530230 5:113085105-113085127 TGGTGCTTCCAGATAACAGGAGG + Intronic
995755327 5:115497416-115497438 GGCTGCCCCCAAAGAACAGATGG + Intergenic
995796786 5:115949693-115949715 TGGTGCCTAAAGAGAAAAGGCGG - Intergenic
997670750 5:135669856-135669878 TGCTGCCTCCTCAGCATAGGAGG - Intergenic
999948022 5:156618663-156618685 TGCTGCCTACAGACATCAGTGGG - Intronic
1000012619 5:157246795-157246817 TGGTGCATCCAAAGAACAAGGGG + Intronic
1000180487 5:158805472-158805494 TCCTGCCTCCAGACATAAGGAGG - Intronic
1001274857 5:170343136-170343158 TGATGCCTGCATTGAACAGGGGG - Intergenic
1002187359 5:177460547-177460569 TGCTGCCTCCTGAGGGCACGAGG + Exonic
1003133059 6:3412222-3412244 TGCTGCCTCCCGAAAAATGGTGG + Intronic
1006939170 6:37740307-37740329 TGCAGCATCCTGAGAAAAGGAGG + Intergenic
1007766263 6:44162097-44162119 TACGGCCCCCAGGGAACAGGTGG - Intronic
1012625721 6:101401878-101401900 TGCTGCCTCCCCAGCAGAGGCGG - Intronic
1013314317 6:108926330-108926352 GGCTGTCTCAGGAGAACAGGTGG + Intronic
1013350402 6:109300622-109300644 TGCTGCTTTCAGTGTACAGGGGG + Intergenic
1014637274 6:123863099-123863121 TGCTTCCTCCAGAGGCCAGTTGG - Intronic
1014737691 6:125113184-125113206 CACCCCCTCCAGAGAACAGGTGG - Intergenic
1015548738 6:134389816-134389838 TGCTGCTTCCAGAAAAGAGTGGG - Intergenic
1017449347 6:154539842-154539864 TGTTGCCTCCTGAGCTCAGGAGG - Intergenic
1018237787 6:161742878-161742900 TGCGGCCTTCAGAGAAAGGGTGG - Intronic
1022323869 7:29312252-29312274 TGGTTTCTCAAGAGAACAGGTGG - Intronic
1022446155 7:30472332-30472354 TGCTGGATGCAGAGAACAGTGGG - Intronic
1023860138 7:44213556-44213578 GGCTGCATCCTGAGCACAGGTGG - Exonic
1026379495 7:69784704-69784726 TGATGCCTTCAGAGAATAGGAGG + Intronic
1026774991 7:73225865-73225887 AGCTGGCACCAGAGAACATGAGG - Intergenic
1027015848 7:74779236-74779258 AGCTGGCACCAGAGAACATGAGG - Exonic
1027072181 7:75166701-75166723 AGCTGGCACCAGAGAACATGAGG + Intergenic
1027220220 7:76209198-76209220 TGCTGTGCCCAGAAAACAGGAGG - Intronic
1027260253 7:76459866-76459888 TGCTGCCTCCGGAGTGCATGAGG + Intergenic
1027311628 7:76957974-76957996 TGCTGCCTCCGGAGTGCATGAGG + Intergenic
1030414603 7:109226903-109226925 TGCTGACTCCACAGAATTGGAGG + Intergenic
1031966910 7:128033051-128033073 CGCTGCCCCCAGAGAACTGGGGG + Intronic
1031972502 7:128074751-128074773 TGCTGCCTCCAGAGAACAGGAGG + Intronic
1032119785 7:129147507-129147529 TGCTGCCTCCCCAGATCAGGGGG + Intronic
1032170189 7:129578193-129578215 TCCTGTCTCCAAAGAAAAGGAGG + Intergenic
1032171238 7:129586306-129586328 TCCTGTCTCCAAAGAAAAGGAGG + Intergenic
1032417619 7:131748984-131749006 TTCTGTTTCCAGAGAAAAGGAGG - Intergenic
1032614058 7:133446955-133446977 TGCAGCCTAGAGAGGACAGGTGG - Intronic
1032701102 7:134379983-134380005 TGGTGCCTCCCGGGTACAGGCGG - Intergenic
1033250346 7:139753202-139753224 GGCTGCCTCCGCAGAACAGAGGG + Intronic
1034479231 7:151307223-151307245 TGCTTCCTCCAGGGAACTGAAGG + Intergenic
1035420114 7:158722553-158722575 GGCTGCCTGCAGGGAACAGAGGG + Intergenic
1037581410 8:20247863-20247885 TGCTGCCTGCTGAGATGAGGAGG - Exonic
1038139684 8:24830786-24830808 TGCTGGGTCCAGAAAACAGGAGG - Intergenic
1044259327 8:90098733-90098755 TGCTTGCTCCATAGAGCAGGAGG + Intergenic
1044849873 8:96417750-96417772 TGCCTCCTCCAGAGTCCAGGAGG - Intergenic
1045392803 8:101732059-101732081 GGCTGCATCCAGGGAAGAGGAGG + Intronic
1047355025 8:124112181-124112203 TGCTGGCTTCAAAGAACGGGAGG - Intronic
1049047885 8:140166906-140166928 TGCTGCCTCCACTCAACAGTTGG + Intronic
1049619671 8:143592383-143592405 GGCTCCCTGCAGGGAACAGGTGG - Intronic
1049996916 9:1043051-1043073 TGCTGACCCCGGAGAGCAGGCGG - Intergenic
1052759247 9:32572938-32572960 TGCTGCCCCCACAGAAGATGGGG - Exonic
1052997354 9:34558210-34558232 TCCTGCCTCCATTGAGCAGGTGG - Intronic
1053076467 9:35138736-35138758 TGCCTGCTCCATAGAACAGGAGG - Intergenic
1054804378 9:69383826-69383848 CCCTGCCCCCAGAGAACAGCAGG + Intronic
1056099091 9:83283650-83283672 GGATGCCTCCACAGAACAGAAGG - Intronic
1056691952 9:88815248-88815270 TGATGCCCCCAGAGAGCAGTGGG - Intergenic
1058652788 9:107192418-107192440 AGCTGCTCCCAGAGATCAGGGGG + Intergenic
1060794966 9:126507243-126507265 GGCTGCCACCAGATAACAGCGGG - Intergenic
1061493101 9:130957052-130957074 GGCTTCCTACAGAGAACATGTGG - Intergenic
1061510565 9:131058538-131058560 TGCTGCCTCCCCAGAGCAGGTGG + Intronic
1061962602 9:133995674-133995696 TGCTGGCTGCGGAGGACAGGTGG - Intergenic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062142675 9:134968435-134968457 TGATGCCTCCAGCGAACCAGAGG + Intergenic
1062743158 9:138192835-138192857 TGCTGGCACCAGGGACCAGGAGG - Intergenic
1062743406 9:138194836-138194858 TGCTGGCACCAGGGACCAGGAGG - Intergenic
1062743655 9:138196837-138196859 TGCTGGCACCAGGGACCAGGAGG - Intergenic
1203368457 Un_KI270442v1:279000-279022 TGCTGGCACCAGGGACCAGGAGG + Intergenic
1185453433 X:295274-295296 TCCTGCCTCCGGAGGACACGGGG - Intronic
1185723100 X:2397497-2397519 TTCTCCCACCAGAGCACAGGCGG - Intronic
1188261930 X:28033330-28033352 TTGTGCCTCCATAGCACAGGAGG + Intergenic
1188262477 X:28036774-28036796 TTGTGCCTCCATAGCACAGGAGG - Intergenic
1189100740 X:38186751-38186773 GGCTGCCTCCAGGAAACAGGTGG - Intronic
1189364270 X:40376347-40376369 TGCTGCCTCCAGAGACCCTTGGG + Intergenic
1191842315 X:65522124-65522146 AGGTGGCTCCAGAGCACAGGTGG + Intronic
1195215210 X:102692682-102692704 TCCTACCTCCAGAGAATAAGAGG + Intergenic
1197143884 X:123149252-123149274 TGCTGTCTGCAGAGAATTGGAGG - Intergenic
1197600136 X:128518455-128518477 GGCTGCCTCCAAAGGAGAGGAGG + Intergenic
1197604627 X:128570812-128570834 TGCTGTCTCCACAGAAGAGTGGG - Intergenic
1197799615 X:130335874-130335896 TGCTGCCTCCCGAGTTCAAGCGG + Intergenic
1198835254 X:140797657-140797679 TGCTTCCTCACAAGAACAGGAGG + Intergenic
1201185630 Y:11399766-11399788 TGCTACCTCCTGAGCACAGTGGG + Intergenic