ID: 1031973303

View in Genome Browser
Species Human (GRCh38)
Location 7:128078804-128078826
Sequence CCTGAGCCTGCAAGCTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031973303_1031973312 14 Left 1031973303 7:128078804-128078826 CCTCAACAGCTTGCAGGCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 164
Right 1031973312 7:128078841-128078863 CAGGAACCAGCACAGAATGCCGG 0: 1
1: 0
2: 1
3: 32
4: 272
1031973303_1031973308 -5 Left 1031973303 7:128078804-128078826 CCTCAACAGCTTGCAGGCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 164
Right 1031973308 7:128078822-128078844 TCAGGGGCCATGGCCCACTCAGG 0: 1
1: 0
2: 1
3: 16
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031973303 Original CRISPR CCTGAGCCTGCAAGCTGTTG AGG (reversed) Intronic
900591589 1:3462686-3462708 CCTGAGCCTGGAGGCAGGTGGGG - Intronic
904756582 1:32771577-32771599 CCTGAGCCTGCAGGCCCTTCAGG + Exonic
906932394 1:50182661-50182683 CCAGAGCTTGCAGGCTGCTGTGG + Intronic
907401592 1:54228062-54228084 CCTGAGACTGCCTGCTGGTGGGG - Intronic
907720873 1:56971047-56971069 GCTGAGCCTGGCAGCTGTTCAGG + Intergenic
907784710 1:57600180-57600202 ACTGAGCTTGCATCCTGTTGGGG - Intronic
908914001 1:69104957-69104979 CCAAAGCCTGCAAACTGTTTTGG - Intergenic
910303955 1:85740537-85740559 CCTGAGCCTGCAGGGGGTGGAGG - Intronic
912707167 1:111923478-111923500 CCTGAGCCTGGAAGCTTCAGTGG - Intronic
919064923 1:192682656-192682678 CCTGAGTATGCATGATGTTGGGG - Intergenic
920130867 1:203730858-203730880 CCTGACTCTGGAAGCTGATGAGG + Intronic
922056011 1:222043356-222043378 CCTGAGACTGGAAGCTGAAGTGG - Intergenic
922742006 1:228019231-228019253 CCCGAGCCTGCGAGCTGAGGTGG + Intronic
923540707 1:234886194-234886216 CCTGAGCCAGGAAGCTGGTGAGG - Intergenic
1063049729 10:2433895-2433917 CCTGAGCCTAGAAGCTGTCCTGG + Intergenic
1067762359 10:49057758-49057780 CCTGAGCAAGCAAGGTGGTGAGG - Intronic
1068872168 10:61956985-61957007 CTTGAGCCTGGAAGCGGTTGAGG - Intronic
1069136545 10:64773396-64773418 CTCTAGCCTGCAAGCTCTTGAGG - Intergenic
1070338575 10:75476370-75476392 GCTGAGTCTGCAAACAGTTGGGG - Intronic
1070507404 10:77126250-77126272 TCTGAACCTGGAAGCTTTTGGGG - Intronic
1070763142 10:79037917-79037939 CCTGAGGCTGCTAGAAGTTGTGG + Intergenic
1071471446 10:85986943-85986965 CCTGAGGCTGGGAGCTGTAGTGG - Intronic
1071488084 10:86116461-86116483 CCTGATCCTTCCAGCTGTTTGGG - Intronic
1072922923 10:99591835-99591857 ACTCAGCCTGCAGGCTGTTGAGG + Intergenic
1072930019 10:99654158-99654180 AGTGAGCTTGGAAGCTGTTGGGG + Intergenic
1074198097 10:111207088-111207110 GCTGAGGCTGGAAGCTTTTGAGG - Intergenic
1074688230 10:115979459-115979481 CCAGACCCTGAAAGCAGTTGGGG - Intergenic
1076512620 10:131023235-131023257 CCTGAGGCTTCGAGCTGTTAGGG - Intergenic
1076734205 10:132451517-132451539 CCAGAGCCTGGAAGGTGCTGGGG - Intergenic
1081621516 11:44621711-44621733 CCTGAGGGTGGAAGCTGTGGGGG - Intergenic
1081942070 11:46951946-46951968 ACTGAGTCAGTAAGCTGTTGAGG + Intronic
1082002091 11:47398787-47398809 CCTGGGCATGCAAGGGGTTGGGG + Intergenic
1082767817 11:57182550-57182572 CCTCAGCCTGGAGGCTCTTGAGG + Exonic
1083528885 11:63398310-63398332 CCTGGAGCTGCAAGCTGCTGGGG + Intronic
1085465721 11:76722033-76722055 CCTGAGCCTGCTATCTGCAGTGG + Intergenic
1087781124 11:102302457-102302479 GCTGAGCTTGCAAGCTGCTGTGG + Intergenic
1088693312 11:112345906-112345928 CCTGGGCCTGGAAGGTGTTGGGG + Intergenic
1089202258 11:116731625-116731647 TCTGGCCCCGCAAGCTGTTGTGG - Intergenic
1089350498 11:117819230-117819252 TCTGGGCCTGCAAGCTTTTGAGG - Intronic
1089495994 11:118908957-118908979 CATCAGCCTGCAAGCTTCTGTGG + Intronic
1091590928 12:1842648-1842670 ACTGAGCCTGCTGGCTGCTGGGG - Intronic
1094458597 12:30668012-30668034 CCTCAGCCTCCAAGTAGTTGGGG - Intronic
1098641232 12:72840020-72840042 CCTCTGCCTCCAAGCTGGTGGGG + Intergenic
1102599395 12:114017753-114017775 CCTGATCCTGCAGGGTGCTGTGG - Intergenic
1104826224 12:131711345-131711367 GCTATGCCTGCAAGCTGTTCCGG + Exonic
1104860797 12:131922372-131922394 CCTGGGCCTGGAAGCAGATGAGG + Exonic
1105852728 13:24350014-24350036 CCTGAGCCTGTAACCTCCTGGGG - Intergenic
1107655944 13:42592206-42592228 GCTGAGCCTTTAACCTGTTGGGG - Intronic
1110404872 13:75138917-75138939 CCCTAGCCTCCAAGCTGTTGGGG - Intergenic
1112890311 13:104221333-104221355 CCTAAGCCTGCAAGCTGGCTGGG - Intergenic
1114269464 14:21092132-21092154 CCTGAGCCTGCGAGCTGGCGAGG - Exonic
1114431573 14:22666157-22666179 GCTGAGAGTGCAAGCTGCTGGGG + Intergenic
1118989743 14:70787165-70787187 CTTGTGACTGCAAGCTGATGTGG - Intronic
1120016401 14:79478880-79478902 CTGGACCCTGTAAGCTGTTGTGG + Intronic
1121318332 14:92975273-92975295 ACTGAGCCTGCACCCTGTGGCGG - Intronic
1122857165 14:104565506-104565528 CATGAGTGTGCAAGCTGTGGGGG + Intronic
1122880963 14:104690228-104690250 CCTAAGCCTGCCAGCGGTTGCGG - Intronic
1126104259 15:45136963-45136985 CCAGGGCCTGCAACCTTTTGGGG + Intronic
1127553254 15:60061877-60061899 CCCTAGCCTACAAGCTTTTGAGG + Intergenic
1128186410 15:65646609-65646631 TCTGAGCCTGCTAGGTGGTGAGG + Intronic
1128818711 15:70633245-70633267 CCCCAGCCTGCAAGATGCTGGGG + Intergenic
1128940037 15:71780612-71780634 CCGCTGCCTGCAAGCTGTTGGGG + Exonic
1129097632 15:73225659-73225681 CCCGAGTCTGCCAGCAGTTGGGG + Intronic
1129187985 15:73922347-73922369 CCTGAGCTGGCATGCTGTGGGGG - Intergenic
1129681277 15:77659814-77659836 CCTGACCTTGAAAGCTGGTGGGG + Intronic
1132339513 15:101069133-101069155 CCTGCTCCTGCAAACTGATGGGG - Exonic
1133025753 16:2988327-2988349 CGAGAGCCTGCAAGGTGGTGAGG + Intergenic
1133805632 16:9124173-9124195 CCTGAAGCTGGAAGCTGGTGGGG + Intergenic
1134767865 16:16777281-16777303 CCTGAGCCTGCAAATAATTGAGG + Intergenic
1139579103 16:67861634-67861656 CCTCAGCCTGCGGACTGTTGGGG + Intronic
1142199044 16:88752567-88752589 CCTGAGGCTGCAAGGGGCTGGGG + Intronic
1142755849 17:2015944-2015966 CCAGAGCCTCCAAGCTGGAGGGG + Intronic
1142905269 17:3037057-3037079 CCTGATCCTGCAGCCTGGTGGGG + Exonic
1143678728 17:8459339-8459361 CCTGTGCTTGCCAGGTGTTGTGG + Intronic
1144269628 17:13603140-13603162 CCAGCCCCTGCAAGCTGTGGAGG + Intergenic
1147331839 17:39703933-39703955 GCTGGGGCTGCAAGCTGGTGGGG + Intronic
1147884247 17:43674112-43674134 CCTGTGCCTGCATGCAGCTGTGG - Intergenic
1150144402 17:62755501-62755523 GCTGGGCCTGCTAGCTGTTCTGG + Intronic
1152529356 17:80907939-80907961 CCTGAGGCCGCACGCTGTCGTGG + Intronic
1152791473 17:82282657-82282679 CCTGAGCTGGGAACCTGTTGGGG + Intergenic
1154349247 18:13569258-13569280 CCTGAGCCTGCAGGATGGGGCGG - Intronic
1154431212 18:14310007-14310029 ACTGAGGATGCAAGTTGTTGGGG - Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1160840829 19:1146455-1146477 CCTGGGCCTCAGAGCTGTTGGGG - Intronic
1163819285 19:19487045-19487067 CCTGAGCCCGCATGCTCCTGTGG - Intronic
925267194 2:2574437-2574459 CCTGGGACAGCGAGCTGTTGGGG + Intergenic
926541198 2:14182950-14182972 CCTGAGCCTGCAAGGGGGAGGGG - Intergenic
928082390 2:28322732-28322754 CCTGGGCCTGCAACATGCTGGGG - Intronic
930346525 2:50189353-50189375 CCTGAGCCTGCTGGGGGTTGGGG + Intronic
930883620 2:56299466-56299488 CCTGAGGCTGCACTCTGTTCTGG + Intronic
931206338 2:60149298-60149320 CCTGAGACTGCCTGCTGTTGAGG - Intergenic
931425224 2:62164686-62164708 GCTGAGCCTGCAGGCTCTTAGGG + Intergenic
932234228 2:70108350-70108372 CTTGGGCCTGGAAACTGTTGGGG + Intergenic
934844409 2:97653198-97653220 CCTCAGCCTCCAAGGTGCTGGGG - Intergenic
934900785 2:98158368-98158390 CCCCAGCCTGCCAGCTGTTGTGG - Intronic
934975892 2:98802022-98802044 CCTGACCCTGCAAGAGGCTGGGG - Intronic
935884653 2:107603588-107603610 CCTGAGCCAGCATGAGGTTGAGG + Intergenic
942531460 2:176914722-176914744 CTTGAATCTACAAGCTGTTGGGG + Intergenic
943604900 2:189965549-189965571 CCTGATCATTCATGCTGTTGAGG - Intronic
945352546 2:208799105-208799127 TCTGAGCCTGGTAGCTGTGGTGG + Intronic
946201737 2:218074481-218074503 CCAGTGCCTGGAAGCTGGTGGGG - Intronic
947545903 2:231010101-231010123 GCTGAGCCTGCAAGTTATAGGGG + Intronic
948597736 2:239091334-239091356 CCCTTGCCTGCAAGCTGCTGTGG + Intronic
1174834264 20:53841408-53841430 CCTCAGCCTGCAGGCTATTCCGG - Intergenic
1174930148 20:54804703-54804725 CCTGATCTTGCAAGGGGTTGGGG + Intergenic
1183080337 22:35451956-35451978 CCTGATCCTGCAGGGTGATGGGG + Intergenic
1183541081 22:38429767-38429789 CCTGGCCCTGCCAGCTGCTGGGG - Intronic
1183744098 22:39683651-39683673 CCTCAACCTGCAAGGTGTGGAGG + Intronic
1184152837 22:42648645-42648667 ACTGACCCTGCAAGCTGTGCTGG - Intronic
1185153889 22:49181910-49181932 CCTGGGCCTGCATGCTAGTGGGG - Intergenic
1185216218 22:49601348-49601370 CCTGCACCTGGAAGCTGTTCTGG - Intronic
950347756 3:12313685-12313707 GCTGAGCCTGGAGGATGTTGTGG + Intronic
953606863 3:44418044-44418066 CCTGAGACTGCAAGGTCTGGAGG - Intergenic
954127227 3:48538739-48538761 CCTGAGGCTGGAAGCTGAGGTGG + Intronic
955340781 3:58123461-58123483 CCTGGGCCTGGAAGCTGTCTCGG + Exonic
955968986 3:64418123-64418145 CACGAGACTGCAAGCTGGTGGGG - Intronic
956142210 3:66157116-66157138 CCTCAGCCTCCAAGCAGCTGGGG - Intronic
960872225 3:122261450-122261472 AGTGAGCCTCCAGGCTGTTGTGG - Intronic
966124621 3:176561724-176561746 CCAGGGCCTCCAAGATGTTGGGG - Intergenic
966787947 3:183636895-183636917 CCTGATCCTGCAGGCAGTTCTGG + Intronic
966995559 3:185276661-185276683 CCTCACCCTGCATGCTGATGAGG - Intronic
968579620 4:1383875-1383897 CCTGAGCCTTCAGGTTGGTGAGG - Exonic
969231322 4:5833712-5833734 CCTGAGCATGGAATCTGGTGTGG + Intronic
969327940 4:6454467-6454489 CCTGAGACTGCACGCTGGAGAGG + Intronic
972985410 4:44757627-44757649 CCTGAACAGGGAAGCTGTTGAGG - Intergenic
973816031 4:54619853-54619875 ACTGAGTCTGCAGGCTGCTGAGG + Intergenic
976058509 4:81098281-81098303 CCTCAGCCTGCAGCCTATTGTGG + Intronic
978397642 4:108298917-108298939 CCTTAGCCTGCAGGCTGGTCTGG + Intergenic
979360820 4:119762899-119762921 CCTCAGCCCTCAAACTGTTGAGG + Intergenic
980158968 4:129137192-129137214 CCTGAGCCTCCAAGTTGTCTAGG + Intergenic
984757898 4:183340979-183341001 CCTGAGGATGCATGATGTTGAGG + Intergenic
984796284 4:183663180-183663202 CCTCAGCCTCCAAGTAGTTGGGG + Intronic
984931584 4:184852496-184852518 CCTGAGCCTGCACCCTCTTAGGG - Intergenic
985381969 4:189404468-189404490 CCTGAGGCTGCACCCAGTTGCGG - Intergenic
985495525 5:202637-202659 TCAGAGCCTTCAAGCTGGTGTGG - Exonic
986027168 5:3861765-3861787 CTTCAGCCTGCAAATTGTTGGGG + Intergenic
986309809 5:6543599-6543621 CCTGAGCCAGGATGCCGTTGGGG - Intergenic
996606905 5:125334163-125334185 CCTCAGCCTGCAGTCTATTGTGG - Intergenic
997101084 5:130970107-130970129 CATCAGCCTGCAAGGTGTTTTGG - Intergenic
997474066 5:134132717-134132739 CCTGAGCCTGCAGGAAGTTGGGG + Intronic
1004233746 6:13855101-13855123 CCTCAGCTTGCAAGGAGTTGTGG - Intergenic
1005497032 6:26396792-26396814 CTTCAGCCTGCAAGGAGTTGGGG - Intergenic
1008664401 6:53701861-53701883 CCAGAGCCTGCCATCTGTTCTGG - Intergenic
1011629234 6:89308661-89308683 CCTGAGCCCTCAAGCGGGTGGGG - Intronic
1011912927 6:92465330-92465352 GCTGAGCTTGTAAGCTGCTGGGG + Intergenic
1013078783 6:106794153-106794175 CTAGAGCCTGCAACCTGGTGGGG + Intergenic
1013587743 6:111594661-111594683 CCTCAGCCTGCAAAGTGCTGGGG - Intronic
1014943322 6:127469134-127469156 CCTGAGCCTGGAATGTGTTTTGG - Intronic
1015893450 6:137992768-137992790 TCTCACCCAGCAAGCTGTTGGGG - Intergenic
1018576416 6:165264472-165264494 CATGAGCCTGCAAGCCTCTGTGG - Intergenic
1018994216 6:168698992-168699014 CCTGTGCCTCCAAGCTGTGGAGG - Intergenic
1019903693 7:4044250-4044272 CCTGAGGCTGCAGGCTGGCGAGG - Intronic
1019916848 7:4138949-4138971 CCGGAGCCTGCTAGGTTTTGAGG + Intronic
1031973303 7:128078804-128078826 CCTGAGCCTGCAAGCTGTTGAGG - Intronic
1032630243 7:133643185-133643207 CCCCAGCCTGCAGGCTATTGTGG - Intronic
1036914653 8:12793460-12793482 GCTGAGGGTGCAAGCTGCTGGGG + Intergenic
1037760104 8:21736144-21736166 CCTGAGCCTGCCAGATGGTAGGG - Intronic
1039118780 8:34122358-34122380 CTTTAACCTGCAAGCTGTTGGGG + Intergenic
1041605407 8:59777335-59777357 CTTGAGACTGCAAGTGGTTGAGG - Intergenic
1043374307 8:79631058-79631080 CAAGAGCCTGCAAGATGTAGCGG + Intronic
1043919340 8:85963329-85963351 TCTGAGGCTGATAGCTGTTGTGG - Intergenic
1045483249 8:102609905-102609927 CCACACCATGCAAGCTGTTGAGG + Intergenic
1046214374 8:111124354-111124376 CCTTAGTCTGCTAGCTTTTGAGG + Intergenic
1051145301 9:14020915-14020937 CCTGAGCAAGCAAGAAGTTGGGG + Intergenic
1052235703 9:26211562-26211584 CCTGACCCTGCATGCTCTTCAGG - Intergenic
1053427580 9:38020887-38020909 CCTTGGCCTGAAAGCTGCTGTGG - Intronic
1053463523 9:38288701-38288723 GCTGAGCCTGGATGCTGTGGAGG + Intergenic
1057818799 9:98315620-98315642 CCTGAGCATGCAACCTGCAGGGG + Intronic
1060730393 9:126033458-126033480 CCTGCCCCTGCAGGCTCTTGGGG - Intergenic
1061059607 9:128243809-128243831 CCTGAGCCTGCAGGCCTTTCTGG + Intronic
1062562682 9:137148697-137148719 ACTGAGCATGCAAGCTGAAGTGG - Intronic
1186299236 X:8181294-8181316 AGTGAGCCTGCAAGCTAGTGGGG + Intergenic
1194467861 X:94255520-94255542 CCTGAGCCTGGAGGCAGATGGGG - Intergenic
1194709301 X:97215612-97215634 CATGAGACTGCAAGGTGGTGTGG + Intronic
1195154956 X:102113626-102113648 CCTGGCCCTGGGAGCTGTTGTGG + Intergenic
1198988597 X:142484227-142484249 GCTGAGCTTGCAAGCGTTTGTGG + Intergenic
1199745403 X:150769239-150769261 CCTGAGCCTGGGAGCAGTTTTGG + Intronic
1200061520 X:153485932-153485954 CGTCAGCCTGCAGCCTGTTGTGG - Exonic
1201439979 Y:13997661-13997683 AGTGAGCCTGCAAGCTAGTGGGG + Intergenic
1201444592 Y:14045047-14045069 AGTGAGCCTGCAAGCTAGTGGGG - Intergenic