ID: 1031973636

View in Genome Browser
Species Human (GRCh38)
Location 7:128080602-128080624
Sequence TGCCACGGGGAAGGGAGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 443}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031973626_1031973636 5 Left 1031973626 7:128080574-128080596 CCTGCAGAATTCAGAGTGCCCTG 0: 1
1: 1
2: 3
3: 14
4: 165
Right 1031973636 7:128080602-128080624 TGCCACGGGGAAGGGAGATGGGG 0: 1
1: 0
2: 3
3: 36
4: 443
1031973624_1031973636 24 Left 1031973624 7:128080555-128080577 CCCTGTGACAGCAGGAGGTCCTG 0: 1
1: 0
2: 2
3: 16
4: 284
Right 1031973636 7:128080602-128080624 TGCCACGGGGAAGGGAGATGGGG 0: 1
1: 0
2: 3
3: 36
4: 443
1031973625_1031973636 23 Left 1031973625 7:128080556-128080578 CCTGTGACAGCAGGAGGTCCTGC 0: 1
1: 0
2: 3
3: 15
4: 279
Right 1031973636 7:128080602-128080624 TGCCACGGGGAAGGGAGATGGGG 0: 1
1: 0
2: 3
3: 36
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031973636 Original CRISPR TGCCACGGGGAAGGGAGATG GGG Intronic
900656758 1:3762474-3762496 TGCCAAGGGGCTGGGGGATGTGG - Intronic
900701030 1:4048715-4048737 TGCCATGGGGAGGGGAGTGGGGG - Intergenic
900742677 1:4340208-4340230 GGCCACAGGGGAGGGAGTTGGGG + Intergenic
901669944 1:10850245-10850267 TTCCATGGGGGATGGAGATGGGG - Intergenic
901742554 1:11351834-11351856 TCCCAGGAGGAAGGGCGATGTGG + Intergenic
901791119 1:11654272-11654294 TGCGGCGGGGAGGGGAGATGGGG - Intronic
901849631 1:12007301-12007323 AGAGATGGGGAAGGGAGATGGGG - Intronic
902198011 1:14812433-14812455 TGACACAGAGAAGGAAGATGTGG + Intronic
902272558 1:15315014-15315036 GTCAACGGGGAAGGGAAATGGGG - Intronic
902413987 1:16228233-16228255 TTCCTCGGGGAGGGGAGAGGGGG + Intergenic
902550205 1:17214816-17214838 TGCCCCGGGGCTGGGAGACGGGG - Intronic
903052093 1:20609081-20609103 TTCCACTGGGAAGGTAGATTTGG - Intronic
903867701 1:26410974-26410996 AGCCACGTAGAAGGGAGGTGGGG + Intronic
905168431 1:36097069-36097091 CTCCAAGGGGAAGGGAGAAGAGG - Exonic
905179303 1:36156474-36156496 AGCCACGCGGAGGCGAGATGGGG + Intronic
905179400 1:36156831-36156853 TGCCACGGGGGATGGGGAAGGGG - Intronic
905650675 1:39654676-39654698 TGCCAAAGGGAAGGGACATGGGG - Intergenic
906016733 1:42588466-42588488 TTCCAGGGGAGAGGGAGATGAGG + Intronic
907037728 1:51230949-51230971 AGCCACGTGGGAGGAAGATGCGG + Intergenic
907692129 1:56679680-56679702 AGCCTAGGGAAAGGGAGATGTGG - Intronic
908435451 1:64101268-64101290 TGCCACGGGGTAGGGAACAGGGG + Intronic
909243177 1:73240506-73240528 TGCCAGGGGGTGGGGAGAGGGGG + Intergenic
909393078 1:75136995-75137017 GGCCAGGGGGAAGGGAGGGGAGG + Intronic
909761912 1:79299450-79299472 TGCCAGGGGGCAGGCAGAAGTGG - Intergenic
912135226 1:106652903-106652925 TGTCGTGGGGTAGGGAGATGGGG - Intergenic
913045327 1:115069116-115069138 TGCCTTAGGAAAGGGAGATGGGG + Intronic
913548425 1:119893199-119893221 TGCAAACGGGAAGGAAGATGTGG + Intergenic
915130665 1:153693436-153693458 TGGCACAGGGTAGGGAGGTGTGG - Exonic
915165988 1:153948037-153948059 TGCCAGGGGGAAGGGAGGAAAGG + Exonic
915358743 1:155273055-155273077 AGCGACGGAGTAGGGAGATGAGG - Intronic
916689917 1:167180295-167180317 TGCCAAAGGGAAGAGAGAGGAGG + Intergenic
917170423 1:172167065-172167087 TGACATGGGGTGGGGAGATGGGG - Intronic
917298257 1:173544852-173544874 TGTCATGGGGTAGGGCGATGGGG + Intronic
917876885 1:179293993-179294015 GCCCGCGGGGAAGGGAGAAGCGG + Intronic
918598727 1:186326172-186326194 TGACACAGGGATGGGAGATGAGG - Exonic
920171421 1:204074430-204074452 CGCCTAGGGGTAGGGAGATGCGG + Intronic
922682616 1:227613194-227613216 GGCCACTGGGAATGGAGATGAGG - Intronic
922812541 1:228425614-228425636 AGTCATGGGGAAGGGAGAAGAGG - Intergenic
923899300 1:238308326-238308348 GGCTACGGGGAAGGGAGGAGTGG + Intergenic
1063974327 10:11403216-11403238 TGCCATGGGGCAGAGAGATCGGG - Intergenic
1066054203 10:31665135-31665157 TGCCCCTGTGAAGGGAGTTGTGG - Intergenic
1066244416 10:33568564-33568586 TGGCAGGGAGAAGGCAGATGTGG + Intergenic
1066320898 10:34302864-34302886 GGCCTCGTGAAAGGGAGATGGGG - Intronic
1067563098 10:47317628-47317650 GGACAGGGGGAAGGGACATGAGG + Intergenic
1067687998 10:48479326-48479348 TCCCACAGAGAATGGAGATGAGG + Intronic
1067800724 10:49357115-49357137 TGCCAAGGGCAAAGGAGAGGAGG + Intergenic
1069761270 10:70813176-70813198 TGGGACGGGGGAGGGAGGTGTGG - Intergenic
1070888526 10:79925227-79925249 TGCCAGGGGGCAGGGAAAGGAGG - Intergenic
1071523525 10:86345440-86345462 TGCCACAGAGAGGGGAGAGGAGG - Intronic
1071553381 10:86584424-86584446 GGGCACGGGGAAGGGAGGAGAGG + Intergenic
1071724810 10:88187466-88187488 TGCCAAGGGGCTGAGAGATGTGG - Intergenic
1072948690 10:99833999-99834021 GACCAAGGGGAAGGGAGCTGGGG - Intronic
1073077080 10:100830824-100830846 TTGCAGGGGGAAGGGGGATGTGG + Intergenic
1074421053 10:113309250-113309272 AGCCTAGGGGAAGGGAGCTGGGG + Intergenic
1075517850 10:123123308-123123330 TCCCACGGGGCGGGGAGAGGGGG + Intergenic
1076457466 10:130610540-130610562 TGCCAAGGGGAAGGGAGAGGAGG - Intergenic
1076598987 10:131645093-131645115 TTTCACGGGGTAGGGAGATATGG - Intergenic
1076704607 10:132294258-132294280 AGGCACGGGGAAGGGGGTTGGGG + Intronic
1076893797 10:133298750-133298772 TGCCACGGCTGAGGGAGACGTGG + Intronic
1077537073 11:3129529-3129551 TGTCACGTGGGAGGGAAATGCGG - Intronic
1077635186 11:3837319-3837341 TGCCAGGGGGTAGTAAGATGGGG - Intronic
1077640968 11:3881244-3881266 TGCCAGGGGAAAGGGAGAGGGGG - Intronic
1077695387 11:4388537-4388559 TGTCAAGGGAAAGGGAGAGGTGG + Intronic
1079558400 11:21791014-21791036 TGCCAGGGGGTGGGGAGCTGGGG - Intergenic
1081569217 11:44279248-44279270 TGTCATGGGGAAGGGCGCTGGGG - Intronic
1081805790 11:45889806-45889828 TGCCTCAGGGATGAGAGATGGGG + Intronic
1081871759 11:46385888-46385910 TGCGACTGGCCAGGGAGATGTGG + Exonic
1083002904 11:59312686-59312708 TGTCATGGGGTGGGGAGATGGGG + Intergenic
1083004080 11:59324854-59324876 AGGCACTGGGAAGGGAGAGGAGG - Intergenic
1083415185 11:62520985-62521007 TCCCAAGGTGAAGGGTGATGTGG - Exonic
1083415288 11:62521591-62521613 TCCCAAGGTGAAGGGTGATGTGG - Exonic
1083415886 11:62525473-62525495 TCCCAAGGTGAAGGGCGATGTGG - Exonic
1083416079 11:62526625-62526647 TCCCAAGGTGAAGGGCGATGTGG - Exonic
1083687006 11:64382526-64382548 TGCATCGGGGGAGGGAGGTGAGG - Intergenic
1083835107 11:65261526-65261548 TGACAAGGGGAATGGAGAAGGGG + Intergenic
1084515291 11:69634663-69634685 TGCTATAGGGAAGGGAGAGGGGG - Intergenic
1084897307 11:72282746-72282768 TGCCATGGGGCTGGGAGGTGGGG + Intergenic
1086414947 11:86579335-86579357 GGCCACAGAGAAGGGAGATCAGG + Intronic
1087808017 11:102577364-102577386 TGACACAGAGAAGGAAGATGTGG - Exonic
1088648891 11:111940057-111940079 TGCCACAGGGAATGGAGCTTTGG + Intronic
1089065492 11:115659317-115659339 GGCCACGGGGAAGGGACACTCGG + Intergenic
1089240575 11:117075167-117075189 TGCCCCTGGGAAGGGAAATCTGG + Intronic
1089292334 11:117444902-117444924 AGCCGCAGGGAAGGGAGAGGAGG + Intronic
1089589149 11:119529460-119529482 TGCTGTGGGGAAGGGAGAGGAGG - Intergenic
1090205460 11:124881281-124881303 TGCCACGGGGAAGGGGAGTAGGG + Exonic
1090687677 11:129141467-129141489 TGTCATGGGGTAGGGGGATGGGG + Intronic
1090723540 11:129499482-129499504 TGTCATGGGGTAGGGGGATGGGG + Intergenic
1091383084 12:75591-75613 TGCTATGGGGCAGGAAGATGTGG + Intronic
1091496432 12:977227-977249 TGCCAAGGGGGAGGGACAAGAGG - Intronic
1091728000 12:2858859-2858881 TGCCAAAGGGGACGGAGATGAGG + Exonic
1093665027 12:21802205-21802227 TGCCTCAGAGAAGGGTGATGAGG + Intronic
1094296815 12:28915648-28915670 TACCATGTGGAGGGGAGATGGGG - Intergenic
1095634847 12:44421008-44421030 TGCCTGGGGGAAGGCAGGTGGGG + Intergenic
1096078836 12:48820534-48820556 TGGCACGGGGGAAGGAGAGGAGG - Intronic
1096539137 12:52294467-52294489 TGTCATGGGGAAGGGAGGAGGGG + Intronic
1096589277 12:52646713-52646735 GGGCACTGGGAAGGGAGAAGGGG - Intronic
1096621425 12:52867993-52868015 TGCCAGGGGGAACTGAGAGGTGG + Intergenic
1096693376 12:53334537-53334559 GGGCACTGGGAAGAGAGATGTGG + Intronic
1097147310 12:56950716-56950738 TGCCCCAGGGAAGGGATCTGAGG + Intergenic
1097151181 12:56981041-56981063 TGCCCCAGGGAAGGGACCTGGGG + Intergenic
1097537368 12:60889209-60889231 TGCCATGGGGGATGGAGGTGTGG + Intergenic
1097695154 12:62768260-62768282 TACCACAGGGCAGGGAGATGGGG + Intronic
1097999121 12:65922092-65922114 GGCCATGGGGAAGGGAAATGTGG + Intronic
1098352853 12:69582227-69582249 TACCAAGGGGAAGAGAGAGGAGG + Intergenic
1098582313 12:72114605-72114627 TGTCAAAGGGAAGGGAGAAGTGG + Intronic
1099219726 12:79898572-79898594 AGCAAAGGGGAAGGAAGATGAGG - Intronic
1099620067 12:84991957-84991979 TGGGAAGGGGAAGGGAGATAGGG + Intergenic
1101959395 12:109237296-109237318 TGCCAAGGTGAAGGAAGGTGTGG + Exonic
1103835912 12:123820887-123820909 GGCCGCAGGGAAGGGGGATGGGG + Intronic
1103909237 12:124343020-124343042 TGCCGCGGGGTATGGAGGTGGGG + Exonic
1104152930 12:126102257-126102279 GGCCATGTGGAAGAGAGATGAGG + Intergenic
1104757170 12:131276575-131276597 TTCCAAGGGGAAGGGAGTTAGGG + Intergenic
1104917380 12:132272858-132272880 AGCCACGGGGAAGGCACACGAGG - Intronic
1106831991 13:33593824-33593846 AGCCCTGGGTAAGGGAGATGGGG - Intergenic
1108233935 13:48381841-48381863 TGTCATGGGGTAGGGAGAGGAGG - Intronic
1108509174 13:51139369-51139391 TGCCAGGGGCTGGGGAGATGAGG + Intergenic
1108579987 13:51819787-51819809 TGCCACTAGGAAGGGTGATGTGG + Intergenic
1110791100 13:79587859-79587881 TGTCATGGGGTAGGGGGATGGGG - Intergenic
1111474458 13:88726330-88726352 TGCCAAGGGCAAGCCAGATGTGG - Intergenic
1112352958 13:98651884-98651906 TGCCAAGGGCACGGGAGTTGAGG - Intergenic
1113498469 13:110753748-110753770 TGCCAAGGGGAATGAAGAAGAGG - Intergenic
1113655422 13:112065625-112065647 TGCCTCGGGGAGGGCAGAGGAGG + Intergenic
1113678293 13:112223239-112223261 TGGCACGGGGAAGTGGCATGGGG - Intergenic
1113809034 13:113126431-113126453 TGCCAAGGGGAACAGAGCTGTGG + Intronic
1114880284 14:26776423-26776445 TGGCAGGGGGTATGGAGATGAGG + Intergenic
1114934972 14:27523652-27523674 TGTCAAGGGCTAGGGAGATGTGG - Intergenic
1117450307 14:55843597-55843619 TGCCACGAGGAAAGGAGGTTGGG + Intergenic
1117735655 14:58765866-58765888 GGTCAAGGGGAAGGGAGGTGGGG + Intergenic
1117979689 14:61330098-61330120 TTCCAAGGGGGAGGGAGATTGGG + Intronic
1118349469 14:64963415-64963437 TGCCAATGGGGAGCGAGATGGGG - Intronic
1118373787 14:65159428-65159450 TGCCACAGGGATGGGAGAGCAGG + Intergenic
1118650648 14:67889972-67889994 TGCCATTGGGATGGAAGATGCGG + Intronic
1120246374 14:82011480-82011502 TGCCCAGGGGAATGGAGATGAGG + Intergenic
1120332956 14:83116941-83116963 TGGCAAGGGGAGGGGAGAGGAGG - Intergenic
1120440580 14:84533142-84533164 TGCAAAGGGAAAGGGACATGAGG - Intergenic
1121551963 14:94809695-94809717 TGTCACGGGGAGGGCAGATGTGG + Intergenic
1121633159 14:95436110-95436132 TGGCTGGGGGGAGGGAGATGGGG - Intronic
1122162707 14:99797115-99797137 TGCCAGGGGTGAGGGCGATGGGG - Intronic
1122254194 14:100464680-100464702 TGAGATGGGGAGGGGAGATGAGG - Intronic
1122286720 14:100656739-100656761 GGCCACACGGCAGGGAGATGTGG + Intergenic
1122364483 14:101186445-101186467 TGCCAACCGGAAGGGAGGTGTGG + Intergenic
1122779640 14:104138345-104138367 TGCCCCGGGGAGGGGCGCTGGGG - Intergenic
1122993675 14:105250915-105250937 TGCCACTGGGAGGGGATCTGGGG - Exonic
1123053120 14:105556984-105557006 GGCCATGGGGGAGAGAGATGGGG - Intergenic
1123494843 15:20814883-20814905 TGCCATGGTGCACGGAGATGCGG + Intergenic
1124057876 15:26259380-26259402 TGTGACTGGGAAGGGGGATGGGG - Intergenic
1124501595 15:30232244-30232266 TTCCACGGGCTAGGGAGAAGAGG - Intergenic
1124741971 15:32306419-32306441 TTCCACGGGCTAGGGAGAAGAGG + Intergenic
1124962776 15:34410608-34410630 TGTCCCGGGGAAGGGAGCAGAGG + Intronic
1124979402 15:34556830-34556852 TGTCCCGGGGAAGGGAGCAGAGG + Intronic
1125611888 15:40976974-40976996 TGCCACGGGGGTGGGGGTTGGGG + Intergenic
1125746599 15:42001277-42001299 TTCCAGGCTGAAGGGAGATGAGG + Intronic
1125858222 15:42972184-42972206 TGCCAGGGGTAAGGGTGTTGGGG - Intronic
1127789851 15:62390314-62390336 TGTCACGGGGAAGGGAGGCTCGG - Intergenic
1128467517 15:67925328-67925350 TGCCACGGGAAAGGGTGGCGTGG - Intergenic
1128480356 15:68032299-68032321 TGCAGTGGGGAAGAGAGATGGGG - Intergenic
1128495345 15:68195204-68195226 TGACACAGGGCAGTGAGATGAGG - Intronic
1128834582 15:70798901-70798923 TGCCACGAGCAAGGAACATGGGG + Intergenic
1128971215 15:72108493-72108515 TGTCACAGGGAAGAGAAATGTGG + Intronic
1129503063 15:76059126-76059148 TTTCACGGGGAAAGGAGATGGGG + Intronic
1130124794 15:81084375-81084397 TGACCCGGGGGAGGGAGAGGAGG - Intronic
1130813572 15:87407082-87407104 TCTCATGGGGAAGGGAGGTGGGG - Intergenic
1132153793 15:99480915-99480937 TGCCAAGGCCAAGGGAGAAGGGG - Intergenic
1132162227 15:99553219-99553241 TGCTATGGGGAAAGGAGCTGAGG - Intergenic
1132305994 15:100812970-100812992 TGCCACAGGCAAGGAGGATGTGG - Intergenic
1133320005 16:4907542-4907564 TGCCAGGGGGAAAGGGGAGGTGG + Intronic
1133831602 16:9328467-9328489 TGCCATGGGTAAGGGAGGAGAGG + Intergenic
1134277348 16:12788576-12788598 AGTGAGGGGGAAGGGAGATGGGG + Intronic
1134797357 16:17053790-17053812 TGCCATGGCAAAGGGAGGTGGGG + Intergenic
1136122211 16:28145356-28145378 TGCCACAGGGTGGGGAGAAGAGG - Intronic
1136128534 16:28203321-28203343 TGACAGGGGGAAAGGAGAGGTGG + Intronic
1136243451 16:28958899-28958921 TGCCAGGGGAAGGGGATATGGGG + Intronic
1137630933 16:49944226-49944248 GGCCACGTGGAAGGGACCTGAGG + Intergenic
1138487845 16:57358189-57358211 AGCCACTGGGAAGGAAGATCAGG + Intergenic
1139507752 16:67407731-67407753 TGCCTGGGGGAAGGGACATAGGG - Intronic
1139574455 16:67832395-67832417 TGCCTCGGGGAGGGGGGTTGAGG - Intronic
1141025417 16:80541646-80541668 TGAAACGGGGATTGGAGATGGGG + Intronic
1141691594 16:85599885-85599907 TGCCACCTGGAAGACAGATGAGG + Intergenic
1141987013 16:87586648-87586670 TGCCAGGAGGAAGGAGGATGGGG + Intergenic
1142207492 16:88791134-88791156 TCCCACGGGGAGGGGAGAAGAGG + Intergenic
1143711922 17:8741407-8741429 GGCCCCGGGGAAGAGAGGTGGGG + Intronic
1144060356 17:11578386-11578408 TCCCAGGGGGTTGGGAGATGGGG + Intergenic
1144353533 17:14422586-14422608 TGCGAAGGAGAAAGGAGATGGGG - Intergenic
1144750804 17:17647008-17647030 TGAGAGGGGGAAGGGTGATGTGG + Intergenic
1144799940 17:17919338-17919360 TGACACGGGAATGGGAGAGGAGG - Intronic
1144939562 17:18928642-18928664 TGCCATGGGGCACGGTGATGGGG + Intronic
1145396161 17:22496659-22496681 TGCCATGGGGCAGGGGGTTGGGG + Intergenic
1145751662 17:27359552-27359574 TGCCAGGGGGAAGGAGCATGTGG - Intergenic
1145822922 17:27853923-27853945 TGCCAGGGGCGAGGGGGATGGGG - Intronic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1146670863 17:34736538-34736560 TGGGAAGGGGGAGGGAGATGAGG + Intergenic
1147881893 17:43659747-43659769 TCCCACGGGTTTGGGAGATGGGG - Intronic
1148999472 17:51742174-51742196 TGGATGGGGGAAGGGAGATGGGG + Intronic
1149169016 17:53787670-53787692 AGTCTGGGGGAAGGGAGATGAGG + Intergenic
1149258677 17:54855840-54855862 TGCAAAGGGAAATGGAGATGGGG + Intergenic
1149610358 17:57954875-57954897 CGCCGCAGGGAAGGGAGACGAGG - Intronic
1149999517 17:61424906-61424928 TGGAACGGGGAAGGCATATGTGG + Intergenic
1150222029 17:63501127-63501149 TGACATGGGGAGGGGAGATGAGG - Intronic
1151291996 17:73157028-73157050 TGCCAAAGGGAAGTGAGGTGAGG + Intergenic
1151359308 17:73579040-73579062 TGCCGAGGGGAAGGGAGGGGTGG - Intronic
1151404670 17:73878622-73878644 AGCCAGTGGGAAGAGAGATGAGG - Intergenic
1151429521 17:74053003-74053025 TGCCCTGGGGAAGGGAGATCAGG - Intergenic
1151499241 17:74478311-74478333 TGCCTGTGGGAAGGCAGATGAGG - Intronic
1151743083 17:75997136-75997158 CCCAACGGGGAAGAGAGATGGGG - Intronic
1151995941 17:77609317-77609339 TGCCAAGGAAAGGGGAGATGTGG + Intergenic
1152035956 17:77873271-77873293 TGGCAAGGGCAAGGGAGCTGAGG - Intergenic
1152153572 17:78618088-78618110 TGCCCTGGGCAAGGCAGATGGGG - Intergenic
1153610759 18:6882246-6882268 TTCCACAGGGAAGAGAGAGGTGG - Exonic
1155020957 18:21896821-21896843 TCCCCAGGGGAGGGGAGATGGGG - Intergenic
1155535463 18:26811855-26811877 TGCCCAGGGGCAGGGAGAGGCGG + Intergenic
1156119193 18:33821167-33821189 TGAGATGGGGGAGGGAGATGGGG - Intergenic
1156465216 18:37344390-37344412 TGCCACGGGGCAGAGACAGGGGG + Intronic
1157319646 18:46624326-46624348 TGCCCTGGGGGTGGGAGATGAGG + Intronic
1157893135 18:51437901-51437923 TGCTACAGGGAAGAGTGATGAGG - Intergenic
1160166936 18:76522159-76522181 TATCACGGGGCAGGGAGATTTGG + Intergenic
1160581295 18:79885835-79885857 GGACACGGGACAGGGAGATGGGG + Intronic
1160581315 18:79885892-79885914 GGACACGGGACAGGGAGATGGGG + Intronic
1160581334 18:79885948-79885970 GGACACGGGACAGGGAGATGGGG + Intronic
1160581370 18:79886062-79886084 GGACACGGGACAGGGAGATGGGG + Intronic
1160581390 18:79886119-79886141 GGACACGGGACAGGGAGATGGGG + Intronic
1160581410 18:79886176-79886198 GGACACGGGACAGGGAGATGGGG + Intronic
1160581430 18:79886233-79886255 GGACACGGGACAGGGAGATGGGG + Intronic
1160581450 18:79886290-79886312 GGACACGGGACAGGGAGATGGGG + Intronic
1160581470 18:79886347-79886369 GGACACGGGACAGGGAGATGGGG + Intronic
1160581490 18:79886404-79886426 GGACACGGGACAGGGAGATGGGG + Intronic
1160581506 18:79886453-79886475 GGACACGGGACAGGGAGATGGGG + Intronic
1160581526 18:79886510-79886532 GGACACGGGACAGGGAGATGGGG + Intronic
1160581546 18:79886567-79886589 GGACACGGGACAGGGAGATGGGG + Intronic
1160581566 18:79886624-79886646 GGACACGGGACAGGGAGATGGGG + Intronic
1160581599 18:79886730-79886752 GGACACGGGACAGGGAGATGGGG + Intronic
1160581619 18:79886787-79886809 GGACACGGGACAGGGAGATGGGG + Intronic
1160581639 18:79886844-79886866 GGACACGGGACAGGGAGATGGGG + Intronic
1160581659 18:79886901-79886923 GGACACGGGACAGGGAGATGGGG + Intronic
1160581695 18:79887015-79887037 GGACACGGGACAGGGAGATGGGG + Intronic
1160969228 19:1760027-1760049 TGCAGAGGGGGAGGGAGATGGGG + Intronic
1161203358 19:3028280-3028302 TGCCAGGGTGAGGGGAGAGGCGG - Intronic
1161327536 19:3670862-3670884 TGCCACGGTGAAGGGAAAGACGG + Intronic
1161592367 19:5134605-5134627 TGCCCAGGGGAAGAGAGAAGGGG - Intronic
1161642202 19:5431316-5431338 AGCCACAGGGAGGGGAGAGGAGG + Intergenic
1161678335 19:5665987-5666009 TGCCAGGGTGAAGGGAGAGATGG - Intronic
1161726467 19:5932244-5932266 GGCAACGGAGAAGGGAGAGGCGG - Intronic
1162389708 19:10381979-10382001 TGCCATGGCCAAGGGACATGTGG + Intergenic
1162561683 19:11421149-11421171 TGGCAAGGGGCAGGGCGATGCGG + Exonic
1163093144 19:15035391-15035413 GGCCAATGGGAAGGGTGATGGGG - Intergenic
1163440021 19:17317904-17317926 AGCCTCTGGGAAGGGAGCTGGGG - Intronic
1163666147 19:18604985-18605007 TACCAGCGGGACGGGAGATGGGG - Intronic
1163838019 19:19587922-19587944 TGCCTGGGTGAAGGGAGAGGAGG + Intronic
1164402201 19:27910072-27910094 TGCCACGGTGGAGGGGGCTGGGG - Intergenic
1165003179 19:32781825-32781847 TCCCAGGGGTAAGGGACATGAGG - Intronic
1165122592 19:33570228-33570250 TGCCACGGGGCTGGCAGGTGGGG - Intergenic
1165242766 19:34481387-34481409 CGGCGCAGGGAAGGGAGATGGGG + Intergenic
1165333309 19:35153592-35153614 TGCAAATGGGAAGGGAGATGGGG + Intronic
1165361299 19:35338479-35338501 GGGAACGGGGAAGGCAGATGGGG + Intronic
1165933521 19:39375524-39375546 TGCCAAGAGGAAGGGACCTGGGG - Intronic
1165974760 19:39665986-39666008 GGCCATGTGGAAGGGAAATGTGG - Intergenic
1165989713 19:39803188-39803210 TGCCAGAGGGGAGGGAGAGGAGG + Intergenic
1166050704 19:40257155-40257177 TACCACGGGGCGGGGAGGTGCGG + Intronic
1166147843 19:40849671-40849693 GGCCACAATGAAGGGAGATGGGG + Intronic
1166151977 19:40881442-40881464 GGCCACAGTGAAGGGAGATGGGG + Intronic
1166178188 19:41089216-41089238 GGCCACGATGAAGGGAGATGGGG - Intronic
1167075144 19:47244024-47244046 GGCATCGGGGAAGGGAGAGGGGG - Intergenic
1168072323 19:53959981-53960003 TGCCAGGGAGAAGAGAGCTGGGG - Intergenic
1168604916 19:57750960-57750982 TGCCATGGGGAAAAAAGATGGGG - Intronic
925117147 2:1389200-1389222 TGCCACAGGGAAGGGTGCTGAGG + Intronic
925345774 2:3170955-3170977 TGCCACGGGGCACGCACATGGGG + Intergenic
925589119 2:5492881-5492903 TGCCACAGGGACGTGTGATGGGG - Intergenic
925842704 2:8007325-8007347 GGCCACTGGGACAGGAGATGAGG - Intergenic
926501750 2:13663152-13663174 TGCCCTGGGGAGGGGAGATGGGG + Intergenic
927259148 2:21069502-21069524 TGCCATGGGGTAGGGGGGTGGGG - Intergenic
928225591 2:29445465-29445487 TGCCACTGGGAAGCGATGTGAGG - Intronic
930502223 2:52235696-52235718 TGTCATGGGGTAGGGGGATGGGG + Intergenic
930707410 2:54518299-54518321 TGTCATGGGGTGGGGAGATGGGG + Intronic
933980628 2:87547567-87547589 TGCCAAGGGGAAAGGATATCAGG - Intergenic
935266631 2:101400559-101400581 TGCAACCGGGGAGGGAGATTGGG - Intronic
936313199 2:111403224-111403246 TGCCAAGGGGAAAGGATATCAGG + Intergenic
937297903 2:120820801-120820823 GGCCACGGAGCAGGCAGATGTGG + Intronic
937427670 2:121813587-121813609 GGCAATGGGGAAGGGAAATGTGG + Intergenic
937453967 2:122025561-122025583 TGCCACAGGGAAGAGAGACTGGG + Intergenic
938479348 2:131646769-131646791 TGCCATGGTGCACGGAGATGCGG - Intergenic
939566280 2:143789911-143789933 TCACAGGGGAAAGGGAGATGGGG + Intergenic
939740780 2:145902703-145902725 TGCCACCTGGAAGTGAGATATGG + Intergenic
939911521 2:147989264-147989286 TGGCAGGGGGTAGGGAGTTGGGG + Intronic
940662642 2:156566380-156566402 TGCCAAGGGGTTGGGAGAGGGGG - Intronic
942823326 2:180142662-180142684 TGTCATGGGGCTGGGAGATGGGG - Intergenic
943618064 2:190116457-190116479 TGCTACGGTGTTGGGAGATGGGG - Intronic
944256660 2:197629440-197629462 TGTCATGGGGCAGGGGGATGGGG + Intronic
944667374 2:201968897-201968919 TGCCTCGGGGAAGGGGAAGGAGG - Intergenic
945272991 2:207960540-207960562 TGCCAAGAGGCAGGAAGATGGGG - Intronic
945476497 2:210287880-210287902 TGCAAAAGGGAAGGGTGATGAGG - Intergenic
945615498 2:212060805-212060827 TGTCATGGGGTGGGGAGATGGGG + Intronic
945699494 2:213152090-213152112 TGACACGGGGAGGGGAGATGGGG - Intronic
945829837 2:214770414-214770436 TGCAATGGAGAAGGCAGATGAGG + Intronic
946155528 2:217804412-217804434 TGCCATGGGGAAGGGGCTTGTGG - Exonic
948834026 2:240615856-240615878 TGCAGCAGGGAAGGGAGATGAGG + Intronic
1169806989 20:9569590-9569612 TGCCACTGAGAAGTGGGATGGGG + Intronic
1172280365 20:33703615-33703637 GGGCATGAGGAAGGGAGATGGGG + Exonic
1172383904 20:34519270-34519292 TGCCACGGGGTAGTAAGATGGGG - Intronic
1172824253 20:37767030-37767052 TGCCACTGGGGAGGCTGATGTGG + Intronic
1172997430 20:39081589-39081611 TGCCCCTGGGAAGGGATATTTGG - Intergenic
1173484585 20:43431064-43431086 TGCCATGGGGAAGGCAGAGAGGG + Intergenic
1174502762 20:50997659-50997681 TGTCATGGGGAAGGGAGGGGAGG - Intergenic
1174865992 20:54136113-54136135 TGTAAGGGGGAAGGTAGATGGGG + Intergenic
1175457449 20:59126217-59126239 TGACACGGGGGAGAGAGAGGGGG - Intergenic
1175645034 20:60663854-60663876 GGCCTCGGGGAAGGGTGCTGGGG + Intergenic
1176282099 20:64319168-64319190 TGCTATGGGGCAGGAAGATGTGG - Intergenic
1178086082 21:29113427-29113449 TGCCAAGAGAAAGAGAGATGGGG - Intronic
1179801361 21:43812940-43812962 AGCCTCGGGGAAGGGGGCTGTGG - Intergenic
1179907726 21:44432932-44432954 GGGCACGTGGCAGGGAGATGAGG + Intronic
1180784097 22:18537248-18537270 TGCCGGGGTGAAGGGAGAGGAGG + Intergenic
1181240998 22:21476600-21476622 TGCCGGGGTGAAGGGAGAGGAGG + Intergenic
1181308893 22:21933123-21933145 GGCCTCGGGGAAGGCAGCTGTGG - Intronic
1181569979 22:23763281-23763303 TGCAGCGGGTGAGGGAGATGTGG - Exonic
1182110776 22:27721692-27721714 AGCCAAGGGGAAGTGAGAAGGGG - Intergenic
1182399302 22:30062314-30062336 CACCATGGGAAAGGGAGATGAGG + Intergenic
1182459959 22:30476507-30476529 GGGCAAGGGGAGGGGAGATGGGG - Intergenic
1182921603 22:34085231-34085253 TCCCAAGGGGAAGTGAGAGGAGG + Intergenic
1183334212 22:37237372-37237394 TGTCACGGGGCAGGGAGAGGTGG + Intronic
1183357593 22:37367874-37367896 TCCCAGTGGGAAGGGAAATGGGG + Intergenic
1183367067 22:37412543-37412565 TGCCAGGAAGAAGGGAGAGGAGG - Intronic
1183508176 22:38220745-38220767 GGCCAGGGGGAAGGGGCATGAGG + Exonic
1184455530 22:44607667-44607689 TGCGGCAGGGAAGGGAGGTGTGG + Intergenic
1184671443 22:46014017-46014039 TGCCGCAGGGAAGGGAGCGGCGG - Intergenic
1184864368 22:47194140-47194162 TCCAACGGGGAGGGGAGGTGTGG + Intergenic
950193323 3:10992717-10992739 GGTCGCGGGGAAGGGAGAGGAGG - Exonic
950465102 3:13148926-13148948 GGCTACAGGGAAGGGAGAGGTGG + Intergenic
950669408 3:14517133-14517155 ATCCACGGGGAAGGGTGCTGGGG + Exonic
951059976 3:18194672-18194694 GGCCAGGGGGAGGGGAAATGGGG - Intronic
951860319 3:27244751-27244773 GGCCACAGGGAAGGGAGAAGAGG - Intronic
952197459 3:31091234-31091256 TACCACAGGGACTGGAGATGTGG - Intergenic
952857655 3:37785426-37785448 TGTGACGGGTAAGGCAGATGTGG - Intronic
953806941 3:46078565-46078587 TGCCTTGGGGAAGGGAGGTCTGG + Intergenic
953932580 3:47013086-47013108 TGCCATGGGCCAGGAAGATGTGG + Intergenic
954602276 3:51878797-51878819 TGACACGGGGAAGGCAGGGGAGG + Intergenic
954749544 3:52805894-52805916 AGCCACGGTGGAGGGACATGTGG - Intronic
954839059 3:53495292-53495314 CGCCGCGGGGAAGGGGGAGGGGG - Intronic
954859341 3:53674691-53674713 TGCTACAGAGAAGGGAGCTGGGG + Intronic
955101423 3:55853743-55853765 TGCCAGGGGCCAGGGAGAGGAGG + Intronic
956165801 3:66397293-66397315 GGCCTCGGGGAATGGGGATGAGG + Intronic
956724982 3:72149550-72149572 TGCAATAGGGGAGGGAGATGGGG + Intergenic
956738923 3:72259774-72259796 GGGCATGGGGAAGTGAGATGGGG - Intergenic
959017961 3:101157355-101157377 GGCTAGGGGGAAGGGAGATGGGG + Intergenic
959777759 3:110188675-110188697 AGCCACGGAGAAGGGAATTGTGG - Intergenic
960230069 3:115215848-115215870 TGTCAGGGGGTAGGGAGCTGGGG - Intergenic
960997202 3:123348103-123348125 TGTCCCGGGGAGGGGAGATGGGG - Intronic
962206857 3:133441912-133441934 TGCAAAGGGGAAGGGAGGAGTGG + Intronic
962728999 3:138262179-138262201 TGCCAGGGGGAAAAGATATGAGG + Exonic
963969422 3:151413294-151413316 AGGTACGGGGCAGGGAGATGAGG + Exonic
964061550 3:152530480-152530502 TGCCGAGTGGAAGAGAGATGGGG + Intergenic
964585486 3:158294667-158294689 AGCCACGGGGAAAGTAGTTGAGG - Intronic
965447494 3:168793619-168793641 GGCCACGGGCAAGGCAGATAAGG - Intergenic
965599673 3:170442441-170442463 TCCAACGGGGAAGGTAGATTTGG - Intronic
966801484 3:183768269-183768291 TGCCAAGAGGAAGGGAGCAGGGG + Intronic
966874911 3:184316004-184316026 TGTCACGGGGAGGGGGTATGTGG + Intronic
967220271 3:187242673-187242695 TGCCACAAGGCAGGGAGAGGCGG + Intronic
968790586 4:2658501-2658523 TGGCACGTGGATGGGAGATCAGG - Intronic
968936711 4:3614838-3614860 TCCCGGGGGGCAGGGAGATGTGG - Intergenic
969244432 4:5923403-5923425 TAACAAGGGGAAGGGGGATGCGG + Intronic
969384162 4:6831956-6831978 TGCCAAGGGAAAGGTAGGTGTGG - Intronic
972189076 4:36568621-36568643 TGCTGCGGGGAATGGGGATGAGG + Intergenic
972461097 4:39303362-39303384 TGCCTCTGGGAAGGGAATTGGGG - Intronic
973616324 4:52681939-52681961 TGCTGAGGGGAAGAGAGATGGGG + Intergenic
975379140 4:73678466-73678488 ATCCACGGGGAAAGGAGAAGGGG + Intergenic
976323039 4:83737535-83737557 TGCCAGGGGCTAGGGAAATGGGG - Intergenic
976822470 4:89222059-89222081 TGCCAGGGGTAAGGGAGTGGGGG - Intergenic
978392495 4:108241911-108241933 TACCATGGGGAAGGGTTATGAGG + Intergenic
979885901 4:126027033-126027055 TGCCAAGAGGAAAGGAGATTTGG + Intergenic
980325999 4:131347016-131347038 TCACAGGGGAAAGGGAGATGGGG + Intergenic
980746197 4:137020036-137020058 TCCCACAGGGAAGGCAAATGAGG + Intergenic
982253968 4:153434596-153434618 TGCCACGGGCTGGGGAGAGGGGG - Intergenic
984505788 4:180616550-180616572 AGTCAGGGGGAAGGGAGGTGGGG + Intergenic
984937311 4:184900495-184900517 TGCCATAGGGAATGGAAATGTGG + Intergenic
985333251 4:188864369-188864391 CTCCACAGGGAAGGGAGATTGGG - Intergenic
985333273 4:188864451-188864473 CTCCACAGGGAAGGGAGATTGGG - Intergenic
986006421 5:3672497-3672519 TGTCATGGGGATGGGTGATGTGG - Intergenic
989562563 5:42868792-42868814 TGTCATGGGGTTGGGAGATGGGG + Intronic
989992465 5:50783194-50783216 GGAGACAGGGAAGGGAGATGGGG + Intronic
990754983 5:59058625-59058647 TTCCAAGGGGAGGGGAGTTGGGG - Intronic
991205142 5:64041569-64041591 TGCCAGGGGTAAGGGAGAGGTGG - Intergenic
991584421 5:68187656-68187678 TGTCACGGAGACGGGAGATGGGG + Intergenic
991711149 5:69409831-69409853 TGCCAGGGGGAAGGGAAAATGGG - Intronic
994325662 5:98442330-98442352 GGCAGCGGGGAAGGGAAATGTGG - Intergenic
994670187 5:102754881-102754903 TGCCCCGGGGAAGGGAGTGAAGG - Intronic
996622287 5:125521820-125521842 GGCCAGAGGGAAGGAAGATGTGG - Intergenic
998429779 5:142060890-142060912 TGCCACAGTGTTGGGAGATGGGG + Intergenic
999345516 5:150816101-150816123 TGCCAGGGGTAAGGGAGGGGTGG - Intergenic
1000104944 5:158050568-158050590 TACCACGGGTAAGGAAGATCTGG + Intergenic
1000260635 5:159585197-159585219 GGCCAAGGGGAAGGGGCATGAGG - Intergenic
1000426424 5:161096193-161096215 TTGCACAGGGAAGGGAAATGGGG + Intergenic
1001381669 5:171309969-171309991 TGCCCGGGGGAAGGGACAGGGGG + Intronic
1001419179 5:171573902-171573924 TGCCAGGGAGCAGGGAGAAGCGG + Intergenic
1001655875 5:173349211-173349233 GCCCAAGGAGAAGGGAGATGGGG - Intergenic
1001997829 5:176176040-176176062 TGCATCGGGGTGGGGAGATGTGG - Intergenic
1002045412 5:176538688-176538710 GGCCATGGGGCAGGGGGATGGGG + Intergenic
1002342727 5:178527415-178527437 AGCCCCAGGGAAGAGAGATGAGG - Intronic
1002813473 6:656947-656969 TGCCACAGGGAAGGCAGCTGGGG + Exonic
1003347893 6:5287594-5287616 TGGGACGGGGAAGGGCTATGAGG - Intronic
1003412333 6:5876636-5876658 GGTAATGGGGAAGGGAGATGAGG - Intergenic
1003487301 6:6590678-6590700 TGCCACTTTGGAGGGAGATGGGG + Intronic
1006135768 6:31895879-31895901 TCCCAGTGGGAAAGGAGATGAGG - Intronic
1006648874 6:35534793-35534815 TGCCACTGGGCCGGCAGATGGGG + Intergenic
1007339887 6:41184565-41184587 TGCCGTGGGGTAGGGAGAAGGGG + Intergenic
1011035290 6:82967476-82967498 TGCCAGGGGGTAGGGAGTGGAGG - Intronic
1011419462 6:87155952-87155974 TGGCTGGGGGAAGGGAGTTGCGG + Intronic
1011481546 6:87798836-87798858 TGCCACGGGGTATGTGGATGGGG + Intergenic
1011746730 6:90413659-90413681 TGCCAGAGGGAAGGATGATGAGG + Intergenic
1011845629 6:91560363-91560385 GGCAACGTGGAAGGGAAATGTGG - Intergenic
1013489367 6:110630308-110630330 GGACACGAGGAAGGGAGAAGAGG - Intronic
1019491194 7:1314379-1314401 GGCCACGGGGAGGGGAGACTGGG - Intergenic
1019519466 7:1454242-1454264 TCCCACGGAGAAGGGAGCAGAGG + Intronic
1019716423 7:2541462-2541484 GGCCACGGTGAAGGGCGCTGGGG + Exonic
1020069685 7:5218198-5218220 TGCCACTGGGACGGGAGAGCTGG + Intronic
1020427196 7:8081191-8081213 TGCCTTGGGGTAGGGAGGTGGGG - Intronic
1020842964 7:13243918-13243940 TGCCTCAGGGAAGGGAGAGTAGG - Intergenic
1022368879 7:29751946-29751968 TGCACAGGGGAAGGGAGCTGAGG - Intergenic
1022585313 7:31603279-31603301 TGCCACGGGGAGGGAGGATGTGG - Intronic
1024787762 7:52927729-52927751 ATCCATAGGGAAGGGAGATGTGG - Intergenic
1027147338 7:75705172-75705194 GGCTTGGGGGAAGGGAGATGGGG - Intronic
1027152644 7:75743478-75743500 AGCCAAGGGCAAGGGTGATGTGG + Intergenic
1027691350 7:81349877-81349899 TGTCATGGGGTGGGGAGATGGGG - Intergenic
1027730594 7:81867238-81867260 TGGCAGGGGGCTGGGAGATGAGG + Intergenic
1029518510 7:101043986-101044008 TGCCATGGGGTAGGGGGATGGGG - Intronic
1030284232 7:107809187-107809209 TGCCACAGTGAAAGCAGATGAGG - Intergenic
1030319056 7:108145458-108145480 TGCAACGGGGGAGGGGGAGGTGG + Intergenic
1030545695 7:110892394-110892416 TTTTAGGGGGAAGGGAGATGGGG - Intronic
1031973636 7:128080602-128080624 TGCCACGGGGAAGGGAGATGGGG + Intronic
1033222916 7:139540495-139540517 TGCCAAGGTGAAGGGGGTTGGGG + Intronic
1033463390 7:141568125-141568147 TGCCAGTGGGAAGGGAGATGTGG + Intronic
1033492338 7:141855608-141855630 TGCCAAGTGCAAGGGAGCTGAGG - Intergenic
1033647264 7:143315261-143315283 AGGCACAGGGAAGGGAGAGGTGG - Intergenic
1034283338 7:149868520-149868542 TGGCACAGGGAAGGGACACGAGG - Intergenic
1035067839 7:156121224-156121246 TGGGATGGGGAAGGGAGATGGGG + Intergenic
1035269265 7:157710479-157710501 TGCCACGGGGCGGGGGGGTGGGG - Intronic
1038108308 8:24463385-24463407 TGCCATGGGGGAGAGAGATTGGG + Intronic
1039193515 8:35003806-35003828 TGCTGGGGAGAAGGGAGATGAGG - Intergenic
1039849162 8:41347442-41347464 TGCAGTGGGGGAGGGAGATGGGG + Intergenic
1039923808 8:41911248-41911270 TGCCATGGGGAAGGGAACAGAGG + Intergenic
1040060585 8:43100095-43100117 TGGCCCGGGGCAGGGAGCTGGGG + Intronic
1041123652 8:54612356-54612378 TGCCATGGGGCTGGGGGATGAGG + Intergenic
1043604599 8:81985230-81985252 TGTCATGGGGTGGGGAGATGGGG - Intergenic
1043794428 8:84518333-84518355 AGCTAAGGGGAAGGGAGAAGTGG + Intronic
1043828362 8:84957197-84957219 TGTCAGGGGGTAGGGAGATAAGG + Intergenic
1044123130 8:88422912-88422934 TGCAATGGGGAAGAGAGATTGGG - Intergenic
1044466931 8:92518101-92518123 TGCAGCGGGAAAGGCAGATGTGG - Intergenic
1048574815 8:135682216-135682238 TGACAAGGGGATAGGAGATGAGG - Intergenic
1048614950 8:136063942-136063964 TGTCGTGGGGTAGGGAGATGGGG - Intergenic
1049625645 8:143618640-143618662 TGACAAGGGTAAGGGAAATGTGG + Intergenic
1052994130 9:34540834-34540856 TGCTAAGGCGAAGGGAGAGGAGG - Intergenic
1053008895 9:34622362-34622384 TGCCACGGGGCAGGAAACTGGGG + Exonic
1053141330 9:35684676-35684698 TCCCACAGGGGAGGGAGGTGAGG - Intronic
1053233192 9:36429252-36429274 TGCCTCTGGGAAGGGAGACTAGG - Intronic
1053314022 9:37036893-37036915 GGCTGCGGGCAAGGGAGATGGGG - Intergenic
1054325181 9:63709233-63709255 TGCCACGGAGAAGGGAGGCCTGG + Intergenic
1055358198 9:75459914-75459936 TGTCAGGGGGAGGGGAGATGGGG + Intergenic
1055477871 9:76681272-76681294 TGCCAGGGGCCGGGGAGATGGGG + Intronic
1056976128 9:91256501-91256523 GGACACGGAGAAGGGAGAGGAGG + Intronic
1057292449 9:93815300-93815322 TCCCACAGGGAAGGGAGGTGAGG - Intergenic
1057647599 9:96891525-96891547 TTTCACGGGGAAGGGCCATGAGG - Intergenic
1058525961 9:105857957-105857979 TGCCTTGGAGAAGGGAGATGTGG + Intergenic
1060979537 9:127784665-127784687 CGCGATGGGGGAGGGAGATGGGG + Intergenic
1061322368 9:129839354-129839376 GGGCAGGGGGAAGGGCGATGAGG + Intronic
1062018368 9:134303817-134303839 TGCCATGGGGAGGGGGGCTGAGG - Intergenic
1062108133 9:134766860-134766882 TGCCAGCGGGAAGGGAAAGGCGG - Intronic
1062190408 9:135245117-135245139 TGCGCCGGGCACGGGAGATGAGG - Intergenic
1062429571 9:136521047-136521069 AGTCACGGGGAACCGAGATGGGG - Intronic
1186366374 X:8898620-8898642 TACTACAGGGAAGGAAGATGAGG - Intergenic
1186697990 X:12058016-12058038 TTCAGAGGGGAAGGGAGATGAGG + Intergenic
1187181567 X:16947354-16947376 TGTCTCAGGGAAGGAAGATGGGG - Intronic
1187298252 X:18023663-18023685 TGTGACGGAGAAGGGAGAAGGGG - Intergenic
1188250607 X:27888833-27888855 TGACAAGGGGTAGAGAGATGTGG + Intergenic
1189010954 X:37045258-37045280 TGTCAGTGGGAAGGCAGATGAGG + Intergenic
1190472592 X:50797887-50797909 TGCCACTGGGAAGGGAAATTAGG + Intronic
1190550237 X:51572237-51572259 TTCCACGGGGCAGGGAGTTGGGG + Intergenic
1192205536 X:69093657-69093679 TACCTCTGGGCAGGGAGATGGGG - Intergenic
1194212329 X:91083423-91083445 TGCCAAGGGCAAGGCAGGTGTGG - Intergenic
1195012893 X:100751018-100751040 TGCGTAGGGGGAGGGAGATGAGG - Intergenic
1195195196 X:102490440-102490462 TGCCATGTGGAAGGGAAATATGG - Intergenic
1196243144 X:113366773-113366795 TGCCAGGGGAAGGGGAGAGGTGG + Intergenic
1197154465 X:123255240-123255262 TGCAAGAGAGAAGGGAGATGGGG + Intronic
1197603027 X:128553094-128553116 GGTAATGGGGAAGGGAGATGAGG + Intergenic
1198466538 X:136909292-136909314 AGCCACGGGAAAGGGCGAGGCGG + Intergenic
1199459411 X:148068466-148068488 TGCCATGGGGTGGGGAGAGGGGG - Intergenic
1199996819 X:153030959-153030981 TGCCCCGGGGACGGCAAATGGGG - Intergenic
1200135780 X:153873920-153873942 GGCCTCGAGGAAGGGAGAAGAGG + Intronic