ID: 1031974179

View in Genome Browser
Species Human (GRCh38)
Location 7:128083553-128083575
Sequence TAGAATCCCCAATGCATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031974179 Original CRISPR TAGAATCCCCAATGCATGCA GGG (reversed) Intronic
901966800 1:12875085-12875107 TAGAAAGCCCAGTGGATGCAAGG + Intronic
901982198 1:13045334-13045356 TAGAAAGCCCAGTGGATGCAAGG + Intronic
901999886 1:13183579-13183601 TAGAAAGCCCAGTGGATGCAAGG - Intergenic
902018371 1:13326726-13326748 TAGAAAACCCAGTGGATGCAAGG - Intergenic
904172317 1:28599933-28599955 AAGAATCCCCTGTGCCTGCATGG - Intronic
904573067 1:31482473-31482495 TAGAAATACAAATGCATGCATGG + Intergenic
905448558 1:38043255-38043277 TAGAACTCCCAGTGCATCCAGGG + Intergenic
909453379 1:75823583-75823605 ACAAATCCCCAATGCATGCAAGG - Intronic
912174977 1:107143123-107143145 TAGAATCCTGAATGCCTTCATGG - Intronic
913085766 1:115435137-115435159 CAGCATCCCCCATCCATGCAAGG - Intergenic
915790478 1:158664533-158664555 TTAAATACCTAATGCATGCAGGG + Intronic
918355341 1:183702627-183702649 TAGGATCCCCACTGTATGAAGGG - Intronic
919474563 1:198018130-198018152 CAGAATCCCAAATCCATTCATGG - Intergenic
922899059 1:229122375-229122397 AAGACTCCCCAGTGGATGCATGG - Intergenic
924144369 1:241058731-241058753 TTGAATGCCTACTGCATGCAAGG - Intronic
1063290224 10:4737553-4737575 TAGAATCCTAAATGCATGAATGG + Intergenic
1067533549 10:47091961-47091983 TAGAGACACCAATGCGTGCATGG - Intergenic
1069302214 10:66922178-66922200 AAATATCCCCAATGCATCCAGGG - Intronic
1070449029 10:76539186-76539208 TAGAAACCCCAAGGAAGGCAAGG + Intronic
1072817708 10:98525931-98525953 TAGATGCTCCTATGCATGCAAGG + Intronic
1073305593 10:102501295-102501317 TACTATCCCCAGTGTATGCAGGG - Intronic
1077714200 11:4565295-4565317 ATGAATACCCAATGCATGGAAGG + Intergenic
1081435104 11:43019040-43019062 TATAATCTCAAATGCATGCCAGG - Intergenic
1081993164 11:47348254-47348276 GAGAAACCCCAAGGCTTGCAGGG - Intronic
1083075339 11:60031583-60031605 AAGAATTCCCATTGCATGGAGGG + Intergenic
1085982994 11:81747157-81747179 AACAATACCTAATGCATGCAGGG - Intergenic
1090705740 11:129334865-129334887 GACAATACCTAATGCATGCAGGG - Intergenic
1091110631 11:132963087-132963109 TAGAACCCCAGATGCTTGCAGGG + Intronic
1092010969 12:5112292-5112314 TAGAAATCTCAATGCCTGCATGG + Intergenic
1093107612 12:15108215-15108237 TAGACTTCCCAATGGAGGCATGG + Exonic
1101796429 12:107978991-107979013 TACAATTCCCAACACATGCAAGG - Intergenic
1102194451 12:111014660-111014682 TATAATCCGCAATCCATGGATGG + Intergenic
1103047042 12:117744788-117744810 TAGAACCCCCAATGCTTTTAAGG - Intronic
1104138709 12:125965326-125965348 GCGAATACCTAATGCATGCAGGG + Intergenic
1104234189 12:126917046-126917068 TAGACTTCCCAATGTATCCAAGG - Intergenic
1104796490 12:131523396-131523418 AAGAATACCTAATGCATGCTGGG + Intergenic
1106902477 13:34368467-34368489 AAAAATACCTAATGCATGCAAGG + Intergenic
1106976791 13:35227812-35227834 TAGAATACACAATGTATGTAGGG + Intronic
1110441627 13:75532889-75532911 TTGAGTCCCCAATGCCTACAGGG - Intronic
1114145606 14:19973520-19973542 TTGAATCCCTAAGGCATGAATGG - Intergenic
1126320670 15:47419432-47419454 TAAAATCTCCAATGAATGGAGGG + Intronic
1129894696 15:79094618-79094640 CAGACTCCCCAATGCCAGCAAGG - Intergenic
1130098363 15:80872937-80872959 TGGCATCCTCAGTGCATGCATGG + Intronic
1130327442 15:82892171-82892193 TACAATACCCAATGCTGGCAAGG + Intronic
1131412029 15:92216310-92216332 TATAATCCCAAAGGCATGCATGG + Intergenic
1131528705 15:93173865-93173887 AAAAATACCAAATGCATGCAGGG - Intergenic
1133558587 16:6928633-6928655 AAGAATCCCACATGAATGCAAGG - Intronic
1139457327 16:67092017-67092039 AAAAATACCTAATGCATGCAGGG - Intronic
1143278856 17:5735055-5735077 TCAAATACCTAATGCATGCAGGG + Intergenic
1143829562 17:9640352-9640374 AAGAATAGCTAATGCATGCAGGG - Intronic
1152127587 17:78456567-78456589 TGGAGTCCCCATTCCATGCAGGG - Intronic
1152285759 17:79411720-79411742 TAGAACAACCATTGCATGCATGG - Intronic
1153617566 18:6948520-6948542 TCACATCCCCAATGCAGGCAGGG + Exonic
1154164556 18:12004818-12004840 TAGAATCCACAATATAGGCAGGG - Intronic
1156317780 18:35986891-35986913 AAGAATAGCTAATGCATGCAGGG + Intronic
1156714813 18:39995165-39995187 TAGAATCTTTAATGCATGCAGGG - Intergenic
1158769511 18:60498176-60498198 TAGATTCCCCAATGGATAAAAGG + Intergenic
1159253867 18:65919933-65919955 TAAAATACCTAATGCATGCGGGG + Intergenic
1164425207 19:28135271-28135293 ACAAATCCCTAATGCATGCAGGG - Intergenic
1164813248 19:31174916-31174938 TAAAAGCCAGAATGCATGCAGGG - Intergenic
930886334 2:56331274-56331296 GGGAATACCTAATGCATGCAAGG + Intronic
933046327 2:77541206-77541228 TACAATCTGAAATGCATGCAAGG - Intronic
935953847 2:108354951-108354973 TCGCAACCCCAATGCCTGCAGGG - Intergenic
936508812 2:113129428-113129450 TAGTATACCCACGGCATGCATGG - Intronic
936784911 2:116083100-116083122 TAGAATTCCTAATACATGCAAGG + Intergenic
937514799 2:122641128-122641150 TTGAATCCCCAATGCATAGCAGG - Intergenic
938652500 2:133398299-133398321 TGGAGTACCTAATGCATGCAGGG + Intronic
939606159 2:144256745-144256767 AAAAATACCTAATGCATGCAGGG + Intronic
940072742 2:149707568-149707590 TTGAATCTCCAATGCATATAAGG - Intergenic
940995363 2:160143843-160143865 TAGAACACAGAATGCATGCAGGG + Intronic
941630663 2:167880549-167880571 TAGAATCAGCAATACATCCAAGG + Intergenic
942530935 2:176909493-176909515 AAAAATACCTAATGCATGCAGGG + Intergenic
944224133 2:197332951-197332973 TATAATCCCAAATGCAAGCAAGG - Intergenic
944910461 2:204305680-204305702 TAGAATGCTTAATGCATCCAAGG - Intergenic
945520526 2:210821755-210821777 ATGAATACCTAATGCATGCAGGG + Intergenic
947486570 2:230555339-230555361 AAAAATACCCAATGCATGCGGGG + Intergenic
947564594 2:231185851-231185873 TTGAACCCCCACTGCATCCAGGG - Intergenic
1170996343 20:21363296-21363318 TAGAATACCTATCGCATGCACGG - Intronic
1171149746 20:22817064-22817086 ACAAATACCCAATGCATGCAGGG - Intergenic
1172193733 20:33077929-33077951 TAGAGTCCCCACTGCCTCCAGGG + Intergenic
1178625724 21:34216833-34216855 TGGCATCCTCAAAGCATGCAGGG + Intergenic
1179366636 21:40764984-40765006 AAAAATGCCCAATGCATGCAGGG + Intronic
950137392 3:10591217-10591239 CTGAATCCCCAGTGCCTGCATGG - Intronic
954597295 3:51837440-51837462 TAAAAGCCCTAATTCATGCATGG - Intergenic
955421063 3:58738300-58738322 AAGAATAGCCAATGCATGCTGGG - Intronic
960258567 3:115537860-115537882 TTGAAACCCCATTTCATGCATGG - Intergenic
960910251 3:122642635-122642657 TAGACTCCACACTGCATGAATGG + Intergenic
961517476 3:127446946-127446968 TACAATTCCCAGGGCATGCATGG - Intergenic
965508740 3:169544904-169544926 ACAAATCCCTAATGCATGCAGGG + Intronic
967642480 3:191882534-191882556 TAGAATCCCCATCGTATCCATGG + Intergenic
968280530 3:197473670-197473692 TAGAATCCCAAATAAAGGCAAGG - Intergenic
970141230 4:12984317-12984339 AAAAATACCTAATGCATGCAGGG - Intergenic
970515489 4:16825406-16825428 TTGAATCCCCAAGGCAAGCAGGG + Intronic
971451141 4:26803166-26803188 TAGTACCCCCAATGCATCCTTGG - Intergenic
974835350 4:67241708-67241730 ATGAATACCTAATGCATGCAGGG + Intergenic
975475287 4:74816235-74816257 AAAAATACCTAATGCATGCAGGG - Intergenic
975724686 4:77280444-77280466 ATGAATACCTAATGCATGCATGG - Intronic
979844659 4:125491973-125491995 TACAAAACACAATGCATGCAGGG - Exonic
980857453 4:138456362-138456384 AAGAATAGCTAATGCATGCAGGG - Intergenic
982674673 4:158361904-158361926 AAGAATCGCTAATGCATGCTAGG + Intronic
986672981 5:10159382-10159404 AAAAATACCTAATGCATGCAGGG + Intergenic
991079365 5:62580594-62580616 CAGAATCCCCCATCCATGCGTGG + Exonic
993962036 5:94309869-94309891 TAGAATCCTAAAGGCATCCACGG - Intronic
996644744 5:125799912-125799934 TATAATCCTCAATGCAGGGAGGG - Intergenic
997257857 5:132443073-132443095 TGCCATCCCCACTGCATGCATGG - Intronic
998951704 5:147399032-147399054 TAGAATGGAGAATGCATGCAAGG - Intronic
1000775022 5:165408789-165408811 TACAAACCCAAATGCTTGCAGGG - Intergenic
1003439552 6:6126603-6126625 TAGAATCCACAGTGCATTTAAGG + Intergenic
1004803818 6:19180224-19180246 AAGAATCCCTAATGAATGCTGGG - Intergenic
1007274506 6:40663480-40663502 TAAAAACCCAAATGCAAGCAGGG - Intergenic
1013194966 6:107837025-107837047 TACAATTCCTAATGTATGCAGGG - Intergenic
1014693384 6:124589785-124589807 GATAATACCTAATGCATGCAGGG - Intronic
1015949437 6:138536739-138536761 ACAAATCCCTAATGCATGCAGGG - Intronic
1022606380 7:31818782-31818804 CAGAATCCCCACTGAATCCATGG + Intronic
1025758635 7:64369735-64369757 TACAATCCCTAGTGCAAGCAGGG - Intergenic
1027674972 7:81145881-81145903 AAAAATACCTAATGCATGCAGGG - Intergenic
1029373250 7:100162701-100162723 ATGAATGCCTAATGCATGCAAGG + Intronic
1031659275 7:124400011-124400033 TAGAATCTCCAAGGTATGGAGGG + Intergenic
1031974179 7:128083553-128083575 TAGAATCCCCAATGCATGCAGGG - Intronic
1032888966 7:136172814-136172836 ACAAATCCCTAATGCATGCAGGG + Intergenic
1034864666 7:154630818-154630840 ACAAATCCCTAATGCATGCAGGG + Intronic
1036014474 8:4767225-4767247 TCGAGTCCCAAATGGATGCAAGG + Intronic
1037248149 8:16860854-16860876 AAAAATACCTAATGCATGCAGGG + Intergenic
1039302954 8:36229757-36229779 AAAAATGCCTAATGCATGCAGGG + Intergenic
1040375185 8:46817917-46817939 TACAATCCCCAGTGGAAGCAGGG - Intergenic
1041387035 8:57315030-57315052 AAAAATACCTAATGCATGCAGGG + Intergenic
1041931540 8:63292659-63292681 TAGAATCCCTAATGAATAGATGG + Intergenic
1047016557 8:120729581-120729603 TTGAATAATCAATGCATGCATGG - Intronic
1051362395 9:16292926-16292948 CAGAATAGACAATGCATGCATGG + Intergenic
1056886052 9:90445148-90445170 TAGAGTCCCCAAAGCAGTCAGGG + Intergenic
1060140406 9:121204601-121204623 TAGAAACCCCAATGGATGTTTGG - Intronic
1186438014 X:9560191-9560213 CAGAATCCCCCTGGCATGCAAGG - Intronic
1191947435 X:66550978-66551000 AAAAATACCTAATGCATGCAGGG - Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197538890 X:127729513-127729535 ATGAATACCTAATGCATGCAGGG - Intergenic
1200858493 Y:7964908-7964930 TATAATCCCCAGTGGAAGCAGGG + Intergenic
1200902884 Y:8450737-8450759 TACAATCCCCAATGGAAGCAGGG - Intergenic
1201528733 Y:14966808-14966830 GAGAATACCTAATGCATGCGGGG + Intergenic
1202260716 Y:22967432-22967454 TATAATCCCCAGTGGAAGCAGGG - Intergenic
1202413703 Y:24601173-24601195 TATAATCCCCAGTGGAAGCAGGG - Intergenic
1202457082 Y:25068913-25068935 TATAATCCCCAGTGGAAGCAGGG + Intergenic