ID: 1031974925

View in Genome Browser
Species Human (GRCh38)
Location 7:128087546-128087568
Sequence CTAGAGACAAAGGTGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031974925 Original CRISPR CTAGAGACAAAGGTGGTGCT GGG Intronic
900491445 1:2951261-2951283 CTAGAGACACACAGGGTGCTGGG + Intergenic
901423753 1:9168003-9168025 CTAGAGACAGGGCTGGAGCTGGG + Intergenic
903677512 1:25073670-25073692 TTAGTGACACAGGTGGTGGTTGG - Intergenic
905028613 1:34867037-34867059 CTGGAGCCTAAGGTGGGGCTGGG - Exonic
906639130 1:47431085-47431107 CCACAGACCAAGGTGGTGGTGGG - Intergenic
907306701 1:53517331-53517353 CTGGACAGACAGGTGGTGCTAGG - Intronic
908433175 1:64078973-64078995 CTAGAGAGAAAGGTGATGGATGG + Intronic
908709116 1:66995281-66995303 CTAGAGTGAATGGTGGGGCTTGG - Intergenic
909823940 1:80101567-80101589 CAGGAGACAAAGGTGGGACTAGG - Intergenic
911571949 1:99528176-99528198 CAAGAGAGAGAGGAGGTGCTGGG + Intergenic
911895020 1:103422554-103422576 CAAGAGAGAAAGGAGGTGCCAGG + Intergenic
912572436 1:110634333-110634355 CTGGAGACCAAGGTGGGGCCAGG - Intergenic
912950829 1:114119028-114119050 CTAGAGATAAAGGTGGGAATCGG + Intronic
913994842 1:143643380-143643402 GTAGAGACAGCGGCGGTGCTGGG - Intergenic
914951161 1:152115556-152115578 GTGGAGACAGAGGTGGAGCTGGG - Intergenic
915431154 1:155868166-155868188 GGAGAGACAAAGATGGTCCTGGG + Exonic
917371231 1:174296318-174296340 CTGGAGACAAAAGAGATGCTGGG + Intronic
919360760 1:196591216-196591238 CAAGAGAGAAAGGAGGTGCCAGG - Intronic
919826897 1:201509405-201509427 GTTGAGTCAAAGGTGATGCTGGG + Intronic
923252205 1:232187781-232187803 TTGGAGTCAAAGGTGGTGCCTGG + Intergenic
1065822922 10:29542962-29542984 CCAGAGACAGAGCTGGAGCTTGG - Intronic
1069006484 10:63323225-63323247 CTAGAAACAACAGTGGTGCCGGG + Intronic
1069641390 10:69957844-69957866 CTTGAGACAATGGTGGTGGGGGG - Intronic
1071295678 10:84217592-84217614 GTAGATACAAAGCCGGTGCTAGG - Intronic
1073901938 10:108232615-108232637 CAAGCAACAAATGTGGTGCTTGG + Intergenic
1078902314 11:15652913-15652935 CAAGAGAGAAAGGTGGGGGTGGG - Intergenic
1079337918 11:19587518-19587540 TTAGAGAAAAATGTGGAGCTGGG - Intronic
1080166584 11:29244327-29244349 CTAGAGAAAAGGGTAGTGGTAGG - Intergenic
1080796970 11:35573924-35573946 CTAGAGAGATAGGTCTTGCTGGG - Intergenic
1081988304 11:47323584-47323606 CTACAGGGAAAGGTGGTCCTGGG - Intronic
1084654290 11:70506167-70506189 CTACAGACAAGGAAGGTGCTGGG - Intronic
1086767613 11:90717737-90717759 CTAGAAACAAAGGTGGAGGTGGG - Intergenic
1087016412 11:93558474-93558496 TTAGGGACAAAGGTGTAGCTGGG + Intergenic
1087174834 11:95087248-95087270 CTAGGGACAAAGGTGGTTGGTGG - Intergenic
1088599579 11:111462693-111462715 CAGGAGGCACAGGTGGTGCTAGG + Intergenic
1089156181 11:116404515-116404537 CTAGGCACTGAGGTGGTGCTAGG + Intergenic
1090080184 11:123607224-123607246 CTAGAAGAAAAGGTGTTGCTGGG + Intronic
1091297660 11:134485400-134485422 GAAGAGTCGAAGGTGGTGCTGGG + Intergenic
1091490921 12:931959-931981 CTAAAGACAAAGATGGAGTTTGG + Intronic
1094275043 12:28664978-28665000 CTTGAGACAGAGGTGTTTCTTGG + Intergenic
1094336134 12:29356332-29356354 CTTTAGACAAAGTTGGAGCTTGG - Intronic
1094606508 12:31953937-31953959 CTAGACACACTGGAGGTGCTGGG + Intergenic
1096216872 12:49802792-49802814 CTAGAGACAGAGGTGGGACTAGG - Intronic
1099867368 12:88300203-88300225 CTAGGGACAAAGGCTGTTCTGGG - Intergenic
1100952736 12:99869605-99869627 CGAGAGGCAAAGGTTGTGGTGGG + Intronic
1103286122 12:119803134-119803156 TTGGAGCCAAAGGTGGTGGTGGG - Intronic
1103701236 12:122849722-122849744 CTAGAGACAGAGAGGGTGGTTGG + Intronic
1104281119 12:127378609-127378631 CCAGAGTCCAAGGTGGTTCTGGG + Intergenic
1104926852 12:132318343-132318365 CGAGAGACAAGGTGGGTGCTCGG + Intronic
1105419769 13:20241760-20241782 CAGGAGTCAAAGGTGGTGCCAGG - Intergenic
1112627791 13:101125782-101125804 CTAGAGGCAAAGGCGGTACTGGG + Intronic
1112649004 13:101370907-101370929 CTAGTGATAAAGGTTGTGGTGGG - Intronic
1115598535 14:34933109-34933131 CCAGGGTCAAAGGTAGTGCTTGG + Intergenic
1120764747 14:88318474-88318496 CAAGAGAAAATGATGGTGCTGGG + Intronic
1121570953 14:94946200-94946222 GTAAAAACAAAGGGGGTGCTGGG + Intergenic
1122913491 14:104845097-104845119 CTGGAGTCAAAGGTGATGGTGGG + Intergenic
1123472914 15:20568241-20568263 GTAGAGCCAGAGGTGGTCCTGGG + Intergenic
1123645091 15:22432112-22432134 GTAGAGCCAGAGGTGGTCCTGGG - Intergenic
1124283720 15:28384526-28384548 GTAGAGCCAGAGGTGGTCCTGGG + Intronic
1124298977 15:28527087-28527109 GTAGAGCCAGAGGTGGTCCTGGG - Intronic
1127805958 15:62520637-62520659 ATAGAGACCAAGGAGGTGGTTGG + Intronic
1128260896 15:66232180-66232202 CAAGAGTCAAAGGTGGCCCTGGG + Intronic
1130062787 15:80581524-80581546 CCAGAGAGAGAGGAGGTGCTTGG - Intronic
1138333998 16:56238033-56238055 CGAGAGTGAAAGGAGGTGCTTGG + Intronic
1138840805 16:60502767-60502789 TAAGGGACAAAGGAGGTGCTGGG + Intergenic
1138883709 16:61049358-61049380 TTGGAGGAAAAGGTGGTGCTTGG + Intergenic
1143617187 17:8059307-8059329 CAAGAGACAATGATGGTGGTTGG - Intergenic
1147559235 17:41498919-41498941 CTACAGAACAAGGTGGGGCTCGG - Intergenic
1147561203 17:41510377-41510399 CCTGAGACACAGGAGGTGCTGGG + Intergenic
1148887349 17:50783416-50783438 TTACACCCAAAGGTGGTGCTGGG - Intergenic
1156707224 18:39897995-39898017 ATAGAGACAGTGGTGATGCTGGG + Intergenic
1158447248 18:57532131-57532153 CAGGAGACAAAGGGGGTGATTGG + Intergenic
1159988532 18:74874553-74874575 CTAGAGGCAAAGGTGCTGACAGG - Intronic
1162409870 19:10499275-10499297 CTGGAGAAAAAGGAGGTTCTGGG - Intronic
1164718118 19:30408401-30408423 CAAGGAACAAAGGTGGTGATGGG - Intronic
1167143811 19:47670604-47670626 CCAGGGGCCAAGGTGGTGCTGGG - Intronic
1167780633 19:51596622-51596644 CTAGAGACAAGAGTGTTCCTGGG + Intergenic
925202827 2:1982665-1982687 GGAGAGACAAAGCTGGGGCTGGG + Intronic
928950226 2:36807374-36807396 CAGGAGACAGAGGCGGTGCTGGG - Intronic
929044982 2:37780338-37780360 CTAGAGACCAGGGAGGTGCAGGG + Intergenic
930930407 2:56875180-56875202 CTAGCGGCAATGGTGGTACTGGG - Intergenic
934564974 2:95333800-95333822 CTTGAGGCAAAGGTGGGACTTGG + Intronic
934760677 2:96854565-96854587 CTTGACACAGAGGAGGTGCTCGG - Intronic
935469159 2:103435990-103436012 CTAGAGAAGAAGGGGGTTCTGGG + Intergenic
938850348 2:135253206-135253228 CTAGCGGCAGAGGTGGTGGTAGG + Intronic
943728056 2:191272533-191272555 ACAGAGGCAGAGGTGGTGCTTGG + Intronic
948821852 2:240553961-240553983 TCTGAGAAAAAGGTGGTGCTTGG - Intronic
1170928199 20:20744943-20744965 CAAGAGAGAGAGGTGGTGCCAGG - Intergenic
1171371480 20:24665155-24665177 CAAGAAACAAATGTGGGGCTGGG - Intronic
1172222429 20:33283151-33283173 CTAAAGACAAAGCCTGTGCTGGG + Exonic
1172393205 20:34580616-34580638 TTAGAGAATCAGGTGGTGCTGGG + Intronic
1172879699 20:38191606-38191628 CCAGAGACAATGGTGGAGGTAGG + Intergenic
1173397286 20:42691242-42691264 GTAGAGAGAAAGGGGGTGGTAGG + Intronic
1174087484 20:48019482-48019504 GTAGAGACAAAGTGGGTGTTTGG + Intergenic
1174964146 20:55192569-55192591 CAAGAGATAATGATGGTGCTTGG - Intergenic
1175827178 20:61942583-61942605 GTAAAAACAAGGGTGGTGCTGGG + Intergenic
1177483798 21:21728769-21728791 CAAGATACAAAGGTAGTGCCTGG + Intergenic
1183097719 22:35563354-35563376 CTGGAGACAGAGGAAGTGCTGGG + Intergenic
1183499180 22:38168226-38168248 CTGGAGACACTGGAGGTGCTTGG + Intronic
1183597587 22:38821964-38821986 CTGGAGACTGAGGTGGGGCTGGG + Exonic
950639654 3:14340530-14340552 CTGGACACATGGGTGGTGCTTGG - Intergenic
950918421 3:16668266-16668288 CTAGACACAAAGCAGGTGCCTGG + Intronic
950924930 3:16731110-16731132 CTAGAGAAAAAGGGAGTGGTGGG - Intergenic
954471293 3:50697634-50697656 CTAGAGGCTAAGGTTGTGCCCGG - Intronic
955126724 3:56119528-56119550 CAAGAGTAAAAGGTGGTTCTAGG - Intronic
955200375 3:56846736-56846758 CTAGAGACAAATTTGGTCCATGG - Intronic
955485183 3:59427976-59427998 CTAGAGCCAGAGGTGGAGGTGGG + Intergenic
956134179 3:66082605-66082627 TTAGAGAAAAAGGTGGTGTTTGG - Intergenic
956670143 3:71681453-71681475 TCAGAGACAGAAGTGGTGCTGGG - Exonic
956842120 3:73150306-73150328 CTAAAGAAACAGGTGGGGCTGGG - Intergenic
960724111 3:120653201-120653223 CTAGGGACAAACGTGGGGTTTGG - Intronic
961361401 3:126370412-126370434 CTAGGGACAACAGTGGTGCCTGG - Intergenic
963730404 3:148965796-148965818 ATAGGGACAAAGTTGTTGCTTGG - Intergenic
966852173 3:184171001-184171023 CCAGAGACAAAAGGGGTCCTGGG - Exonic
968315629 3:197722167-197722189 CAGGAGGCAAAGGTGGAGCTGGG + Intronic
968604291 4:1524568-1524590 CTAGGGACGAAGGTGGTGGTGGG - Intergenic
977928627 4:102728861-102728883 CCAGAGCCAAAGCTGGGGCTTGG + Intronic
979154481 4:117365655-117365677 CTAGACACACAGGTTGTGCTGGG + Intergenic
979476044 4:121158382-121158404 CTAGTGACAAAGGTAAGGCTGGG + Intronic
979781842 4:124661355-124661377 CTACAGATAAATGTGGTGTTGGG - Intergenic
982742348 4:159071047-159071069 CCAGAGACAAAGATGTTTCTTGG - Intergenic
985128590 4:186719616-186719638 TTAGTGACAAAGCTGGAGCTAGG - Intronic
986063353 5:4212422-4212444 CTAGAGAGGAAGCTGGTGCTAGG - Intergenic
987888381 5:23842073-23842095 TTGGGGACACAGGTGGTGCTTGG + Intergenic
988507107 5:31833170-31833192 CTAGAAACAAAGGTGGAGGCTGG + Intronic
989536815 5:42573536-42573558 GTAGAGATAAAGGTGGTGTCAGG - Intronic
992482626 5:77166998-77167020 CTAGGGACCAATGTGGTGCCGGG - Intergenic
995725115 5:115173775-115173797 CTATTGAAAAAGGAGGTGCTAGG - Intronic
995920513 5:117305420-117305442 CTAGACATAAAGGTTGTGCAAGG - Intergenic
996525908 5:124479231-124479253 CCAGATACAAAGGAGATGCTTGG - Intergenic
997021038 5:130002079-130002101 CTATAAACAAAGGTGGTGCTTGG + Intronic
997601419 5:135141228-135141250 CTGGAGACCAAGGTGGAGCCAGG - Intronic
998275926 5:140753471-140753493 CTGGTGACAATGTTGGTGCTGGG + Intergenic
999075645 5:148793027-148793049 TTAGGGAGAAAGGTGGTGGTAGG - Intergenic
1000005906 5:157184794-157184816 CAGAAGACCAAGGTGGTGCTTGG - Intronic
1000602211 5:163288391-163288413 CTATAGAAAAAGGTGGCTCTTGG - Intergenic
1004016967 6:11740733-11740755 GTAGAGACAATGGTGATGGTCGG + Intronic
1004594589 6:17087040-17087062 CTAAAGACAAAGGTGTGGGTGGG - Intergenic
1007717874 6:43867748-43867770 CTTGAGGCAAAGGTGGTGGCAGG - Intergenic
1009906459 6:69875098-69875120 CTAGAGACCAATGTGCTTCTTGG + Intronic
1010995074 6:82523570-82523592 GTAGAGACAAGGGTGGTCCCTGG + Intergenic
1014343183 6:120233749-120233771 CTAGACCCAAAGGTGCTGCAGGG + Intergenic
1014533629 6:122590790-122590812 CTGGAGATAAAGGTGATGGTGGG + Intronic
1017608462 6:156158347-156158369 CTAGAGACAAAGATGGAGGTAGG + Intergenic
1017946781 6:159102438-159102460 TTAGAGACAGAGAGGGTGCTGGG - Intergenic
1018391120 6:163342862-163342884 ATACAGGCAAAGGTGGTCCTTGG + Intergenic
1018853218 6:167656078-167656100 CTAGCGACAAAGATGGGCCTGGG - Intergenic
1020158434 7:5747593-5747615 TTAGAGACAAAGGTCATGCACGG + Intronic
1021746468 7:23745769-23745791 CTAGTGACAATGGTGGTTGTGGG + Intronic
1022038181 7:26553936-26553958 GATGAGACAAAGGTGGGGCTGGG - Intergenic
1022430575 7:30315709-30315731 CTAAAGAAAAAGGTGGGGCGGGG + Intronic
1022496959 7:30859389-30859411 CTAGAGCCCAGGATGGTGCTTGG + Intronic
1024262767 7:47584157-47584179 CTAGAAACAAAGGTGTGGTTGGG - Intergenic
1024530163 7:50384633-50384655 CTGGAGACAAAGGTGGTACCTGG + Intronic
1026280865 7:68920649-68920671 CCAGAGCCCATGGTGGTGCTAGG - Intergenic
1027795651 7:82690691-82690713 CTAGAGAAAAAGGTGGAGGAAGG - Intergenic
1029241469 7:99166290-99166312 CTAGAAACATAGTAGGTGCTAGG - Intergenic
1030428560 7:109412167-109412189 CTAGAGACAAGGCTGGTGATTGG + Intergenic
1030562501 7:111107416-111107438 TTAGAGACAAAGGTGGTAAGAGG - Intronic
1031974925 7:128087546-128087568 CTAGAGACAAAGGTGGTGCTGGG + Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1035366828 7:158353913-158353935 CCAGAGACAAAGGTGGGGGTGGG + Intronic
1039809154 8:41029087-41029109 CTAGAGACAGAGGTGATGTGGGG - Intergenic
1040514540 8:48124195-48124217 CCAGAGCCACAGGTGCTGCTGGG + Intergenic
1040850130 8:51891867-51891889 CAAGAGAAGAAGGTGGTGGTGGG - Intronic
1043731197 8:83685029-83685051 CTTGATACAAAGGTCTTGCTAGG - Intergenic
1046009761 8:108532099-108532121 CTAGATACATAGTAGGTGCTTGG + Intergenic
1047001669 8:120579301-120579323 TTAGAGGCATGGGTGGTGCTAGG - Intronic
1049655238 8:143794270-143794292 CCAGAGACAGAGGTGATGGTGGG + Intronic
1057453687 9:95188420-95188442 CTAGGGGCAATGATGGTGCTGGG - Intronic
1059127869 9:111711028-111711050 TTAGAGAGAAAGGTTGGGCTAGG + Intronic
1060887954 9:127168804-127168826 CTAAGGACAAAAGTGGGGCTGGG - Intronic
1061647314 9:132014980-132015002 TTAGAGACAAAGTTAGTTCTGGG + Intronic
1185744221 X:2558748-2558770 GTAGAGACAAAGTTGGTGTGTGG + Intergenic
1186297173 X:8162797-8162819 GGAGGGACAAAGGTGATGCTGGG + Intergenic
1186354829 X:8779805-8779827 GGAGGGACAAAGGTGATGCTGGG - Intergenic
1186376974 X:9014140-9014162 GGAGGGACAAAGGTGATGCTGGG - Intergenic
1186443122 X:9603294-9603316 CTAAAAACAAAGGTGGTGGGTGG - Intronic
1195244544 X:102983707-102983729 CCTGAGACTGAGGTGGTGCTGGG - Intergenic
1195621980 X:106966203-106966225 CTAGAGAAAAAGCTGAGGCTGGG + Intronic
1196741606 X:119030112-119030134 CTAGACACAAAGGTTCTGCAAGG - Intergenic
1197035123 X:121864209-121864231 AGAGAGACAATGGTGGTGCTAGG + Intergenic
1198159310 X:133991258-133991280 ATAGAGTAACAGGTGGTGCTGGG - Intergenic
1198427559 X:136535251-136535273 CTAGATACAAAAGATGTGCTGGG + Intronic
1199851827 X:151729309-151729331 TTATAGACAAAGATGGGGCTGGG - Intergenic