ID: 1031975281

View in Genome Browser
Species Human (GRCh38)
Location 7:128089749-128089771
Sequence GACTGTTCCACAAGCCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 134}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031975275_1031975281 -1 Left 1031975275 7:128089727-128089749 CCACCACCCTCACAGAGAAAGGG 0: 1
1: 0
2: 5
3: 44
4: 315
Right 1031975281 7:128089749-128089771 GACTGTTCCACAAGCCAGGAAGG 0: 1
1: 0
2: 2
3: 11
4: 134
1031975273_1031975281 10 Left 1031975273 7:128089716-128089738 CCAGCATTGCGCCACCACCCTCA 0: 1
1: 0
2: 0
3: 14
4: 308
Right 1031975281 7:128089749-128089771 GACTGTTCCACAAGCCAGGAAGG 0: 1
1: 0
2: 2
3: 11
4: 134
1031975271_1031975281 12 Left 1031975271 7:128089714-128089736 CCCCAGCATTGCGCCACCACCCT 0: 1
1: 0
2: 1
3: 13
4: 247
Right 1031975281 7:128089749-128089771 GACTGTTCCACAAGCCAGGAAGG 0: 1
1: 0
2: 2
3: 11
4: 134
1031975278_1031975281 -7 Left 1031975278 7:128089733-128089755 CCCTCACAGAGAAAGGGACTGTT 0: 1
1: 0
2: 2
3: 19
4: 215
Right 1031975281 7:128089749-128089771 GACTGTTCCACAAGCCAGGAAGG 0: 1
1: 0
2: 2
3: 11
4: 134
1031975277_1031975281 -4 Left 1031975277 7:128089730-128089752 CCACCCTCACAGAGAAAGGGACT 0: 1
1: 0
2: 0
3: 12
4: 222
Right 1031975281 7:128089749-128089771 GACTGTTCCACAAGCCAGGAAGG 0: 1
1: 0
2: 2
3: 11
4: 134
1031975279_1031975281 -8 Left 1031975279 7:128089734-128089756 CCTCACAGAGAAAGGGACTGTTC 0: 1
1: 0
2: 0
3: 19
4: 454
Right 1031975281 7:128089749-128089771 GACTGTTCCACAAGCCAGGAAGG 0: 1
1: 0
2: 2
3: 11
4: 134
1031975272_1031975281 11 Left 1031975272 7:128089715-128089737 CCCAGCATTGCGCCACCACCCTC 0: 1
1: 0
2: 0
3: 18
4: 146
Right 1031975281 7:128089749-128089771 GACTGTTCCACAAGCCAGGAAGG 0: 1
1: 0
2: 2
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031975281 Original CRISPR GACTGTTCCACAAGCCAGGA AGG Intronic
900111290 1:1006665-1006687 GCCTGTCCCACAGGACAGGATGG - Intergenic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
907073470 1:51558330-51558352 GTCTGGTCCCCAAGCAAGGAAGG - Intergenic
907417108 1:54322172-54322194 GCCTGTCCCAGCAGCCAGGAAGG - Intronic
907616714 1:55933837-55933859 GCCTGTGGCAGAAGCCAGGAGGG - Intergenic
912507831 1:110168270-110168292 AAGAGTTCCACAAGCAAGGAAGG - Intronic
915170891 1:153976736-153976758 AACTCTTCCACCAGCCAGCATGG + Exonic
921454927 1:215359333-215359355 GACTGTTTTACAAGCCATGGAGG - Intergenic
922729933 1:227944595-227944617 AACTGGTCCAGAAGCCAGGCTGG - Intronic
924147899 1:241096013-241096035 GACTGTTCCACACGGAAGGAAGG - Intronic
1062804419 10:406667-406689 GACTGGTCCCCAAGCAAGAAAGG - Intronic
1063952647 10:11238134-11238156 GACAGTTCCACAAGTCAGAAAGG + Intronic
1066511000 10:36095717-36095739 CACAATTCCACAGGCCAGGAAGG - Intergenic
1069605230 10:69734854-69734876 GACTGTTGCATCAGCCATGAAGG + Intergenic
1069989188 10:72304060-72304082 GACTGTTCCAGAACCCAGAGAGG + Intergenic
1072600068 10:96917312-96917334 CAATATTCCACAAGCCAAGAGGG - Intronic
1075600032 10:123761046-123761068 GGCTGTTCCCTAAGCCAGGAGGG - Intronic
1076580155 10:131502299-131502321 GACTGCTCCACAGGACAAGAGGG - Intergenic
1076701600 10:132275967-132275989 GACCGTTCCGCATGCCAGGGTGG - Intronic
1077027302 11:446556-446578 GACTGCTCCCCAAGTCAAGATGG - Intergenic
1077124633 11:926845-926867 AACCGTTAAACAAGCCAGGAAGG + Intronic
1077899388 11:6477114-6477136 CACTGCTCCTCTAGCCAGGAGGG + Exonic
1079311511 11:19370686-19370708 GACTGTTACACAATCCAGGCTGG - Intronic
1080514396 11:33006650-33006672 GACTGTTACTCAGGCCAGGGTGG + Intergenic
1080568779 11:33536893-33536915 GTCTGTTCTTCATGCCAGGATGG + Intergenic
1083401890 11:62429231-62429253 GACTGGTCCACAGGCAAGAATGG + Intergenic
1083594085 11:63910830-63910852 GGCTGTTCCATAGGGCAGGAGGG - Exonic
1084519602 11:69655401-69655423 GAGTGCTCTACAAGGCAGGAAGG - Intronic
1086586732 11:88461408-88461430 GACAGATCCACAAGACAGAAAGG - Intergenic
1088582037 11:111325874-111325896 GACTACTTCACAAGCAAGGATGG - Intergenic
1089256791 11:117198429-117198451 GACTGTTCCTAAAGGGAGGAAGG + Intergenic
1091214219 11:133890636-133890658 GCCTGTTCTTCAAGCAAGGAGGG + Intergenic
1095908751 12:47404713-47404735 AACTGTTCCACATGCATGGATGG + Intergenic
1095917414 12:47494171-47494193 TACTTTTCCACATGCCAGGAGGG - Intergenic
1096515037 12:52151083-52151105 GAAGGTTCTAGAAGCCAGGAGGG + Intergenic
1096900594 12:54876002-54876024 AACTGTACCACAAGCCACCAAGG + Intergenic
1097709019 12:62898034-62898056 GACTGTTCCCCAAGCTGGGCTGG - Intronic
1099419872 12:82443827-82443849 CACTGTCCCCCAACCCAGGAGGG + Intronic
1101904435 12:108814458-108814480 GACTTTTTTTCAAGCCAGGAAGG + Intronic
1103215783 12:119200319-119200341 GACTGGTCCCCAAGCAAGAAGGG + Intronic
1103559273 12:121784053-121784075 TGCTGTTCCACATGCCAGGAAGG + Intronic
1105052402 12:133066391-133066413 ACCTGTACTACAAGCCAGGATGG + Intergenic
1107413480 13:40178906-40178928 GATTGTTCCAGTAGCTAGGAGGG - Intergenic
1108032998 13:46256417-46256439 GACAGAGCCAGAAGCCAGGAGGG + Intronic
1111159790 13:84379341-84379363 GACTGGTACACAAGCCAGTCTGG - Intergenic
1112771123 13:102795920-102795942 GACAGTACCACAAGACAGTAGGG - Intronic
1114246280 14:20917378-20917400 GATTTCTCCAGAAGCCAGGAAGG + Intergenic
1118787632 14:69059305-69059327 GACTCTTCTCCTAGCCAGGAAGG + Intronic
1120731417 14:88006502-88006524 GACTTAACCACAAGACAGGATGG - Intronic
1121615937 14:95313854-95313876 GAGTGTTCCACAGGTCAGGGAGG + Intronic
1122376546 14:101264355-101264377 GCCTGTTCCAACAGCCAGGCGGG - Intergenic
1122951207 14:105046101-105046123 GACTGTCCCACAGGCCTGGTGGG - Intergenic
1127731955 15:61809845-61809867 GACTGCTTGACAAGCCAGGGAGG + Intergenic
1127824663 15:62692339-62692361 CCCTGTTCCACAACCCAGGCAGG - Intronic
1128578355 15:68791460-68791482 AACTGTTCCACCAGCCAGGTGGG + Intronic
1129651293 15:77492501-77492523 GACTGTTAAAATAGCCAGGATGG + Intergenic
1129737146 15:77972811-77972833 CACTGTTCCTGAACCCAGGAGGG - Intergenic
1131194970 15:90348420-90348442 GACAGTTGCACAAGACAGGTAGG - Intergenic
1134804614 16:17113926-17113948 GACTCATCCACCTGCCAGGAGGG + Intronic
1137452487 16:48589962-48589984 GACTGGTCCCCAAGCAAGAAGGG - Intronic
1138683134 16:58701331-58701353 CACTGTTCCACATGACTGGAAGG - Intergenic
1139066673 16:63324263-63324285 GTCTGATCCCCAAGCAAGGAGGG - Intergenic
1139687606 16:68616577-68616599 AACTGTTCCCCAGGGCAGGATGG + Intergenic
1142173644 16:88635175-88635197 ACCTGTTCCCCATGCCAGGAGGG + Intergenic
1143363358 17:6389064-6389086 AACTGATACACAAGCCAGTATGG - Intergenic
1146442882 17:32912547-32912569 GACAGCGCCACCAGCCAGGAAGG - Intergenic
1147237651 17:39069629-39069651 GGCTGTTCCACAGGACAGGAGGG + Intronic
1147669193 17:42167041-42167063 GAGAGTTCAACAAGCCAGGGTGG - Intronic
1148195637 17:45710773-45710795 GAATGTTTTACAAGCCAGCAGGG + Intergenic
1152812655 17:82389352-82389374 GGCTGTTCCAGGAGCCACGAGGG - Intronic
1153022864 18:647142-647164 GACTGTTCCAAAAGGGGGGATGG + Intronic
1155309427 18:24509554-24509576 TCCTGTTCCACAAGACAGAAAGG + Intergenic
1156379467 18:36544634-36544656 GACTGCTCCGCATGCCAGGGTGG - Intronic
1157460589 18:47889326-47889348 GACTCTACTACAAGACAGGAAGG + Intronic
1164741099 19:30576136-30576158 GGCTTTTCCACCAGGCAGGAAGG + Intronic
1165170740 19:33890014-33890036 GCCTGTCCCACAGGGCAGGAAGG + Intergenic
925977243 2:9149951-9149973 GACTGTTCCAGCAGCCAGTGCGG + Intergenic
926606269 2:14901861-14901883 GACAGTTCCACAAGCAGGAATGG + Intergenic
927555139 2:24025729-24025751 TACTGGTCCACAAGCCAGGTTGG - Intronic
932410655 2:71545444-71545466 GATTGTTCCCCCAGCGAGGAAGG - Intronic
936328172 2:111523345-111523367 GACTGTTCCACGAGCACGTAAGG + Intergenic
941404253 2:165069391-165069413 GACTGGTCCCCAGGCAAGGAGGG + Intergenic
946399049 2:219459253-219459275 CACAGTTACACCAGCCAGGAAGG - Intronic
949005035 2:241641071-241641093 GACTGTTGAACAAGCCAGCAAGG + Intronic
1169694333 20:8370198-8370220 GACTCTACCACCAGCCAGGTAGG - Intronic
1171281595 20:23904022-23904044 GACTGTTGCATTAACCAGGATGG + Intergenic
1176821724 21:13664464-13664486 GCCAGCTCCGCAAGCCAGGAAGG + Intergenic
1179168100 21:38950994-38951016 AACTGTCCCATAAACCAGGAAGG - Intergenic
1180009756 21:45041521-45041543 GAGGGTTACACAACCCAGGACGG + Intergenic
1182151140 22:28028018-28028040 GCCTCTCTCACAAGCCAGGAAGG - Intronic
1184535147 22:45081703-45081725 GACTGTTCCATACTCAAGGAAGG - Intergenic
1184972711 22:48037888-48037910 GTCTGTACCACAAGCCATGGAGG + Intergenic
1185081296 22:48710741-48710763 TATTGTTCCCAAAGCCAGGAAGG - Intronic
949659272 3:6258869-6258891 GTCTTGTCCACAAGCAAGGAAGG + Intergenic
953727187 3:45410150-45410172 AACTGTTCCACAAGAAAGGGGGG - Intronic
953745436 3:45570463-45570485 GTCTGGTCCCCAAGCAAGGAGGG - Intronic
955037879 3:55286423-55286445 GACTGTGACACAAGCAAGAAAGG + Intergenic
959213855 3:103424429-103424451 GACTGTTCCACATGCCCGTGAGG - Intergenic
962352398 3:134665368-134665390 GGCTGTTGCACAAGCAAGGTGGG + Intronic
963288755 3:143465074-143465096 GACTTGGCCACCAGCCAGGAGGG - Intronic
963975232 3:151472965-151472987 TACAGTTCCACAAGTCAGAAGGG - Intergenic
964086909 3:152830123-152830145 GAAAGTTCTACAAGACAGGATGG + Intergenic
970457187 4:16236563-16236585 AACTATTCCACATGCCAGCAAGG - Intergenic
975512557 4:75209837-75209859 ATTTGTTCCACAAGCCAGAAGGG + Intergenic
976560115 4:86491252-86491274 GACAGCTCCACAGGGCAGGAAGG + Intronic
978473522 4:109098247-109098269 GACACTTCCACAAGACAGTATGG - Intronic
982195659 4:152910196-152910218 TACTGTTCTTCAAGCCAAGATGG - Exonic
983027862 4:162759267-162759289 CACATTTCCACAAGGCAGGAAGG - Intergenic
983535716 4:168854845-168854867 GACTGTTCTCCAGGTCAGGAGGG + Intronic
985520435 5:371680-371702 GTCGGTTCCACAGGCCTGGAAGG - Intronic
988916742 5:35902151-35902173 GACTGTGCCAGAAGCCATAAAGG + Intergenic
990782396 5:59379987-59380009 GAGGATTCCAAAAGCCAGGAGGG - Intronic
991963704 5:72070634-72070656 GCCTATCCCACAGGCCAGGAGGG + Intergenic
992563619 5:77976186-77976208 AACTGTTCCAAATGCCTGGAAGG + Intergenic
992711393 5:79460909-79460931 GACAGTCCCACTAGCAAGGATGG + Intronic
996623335 5:125537863-125537885 AACTCATCCACATGCCAGGAGGG - Intergenic
999529097 5:152442597-152442619 GTCTGGTCCCCAAGCAAGGACGG - Intergenic
1001197194 5:169684418-169684440 GATTGCTCCACAAGTGAGGATGG - Intronic
1002963228 6:1937160-1937182 GAGTGTTCCACAAGCCTGGATGG - Intronic
1003150760 6:3547008-3547030 GAATGTTCCAGAATCAAGGAGGG + Intergenic
1003798431 6:9632459-9632481 GACTGTTCCAGAGATCAGGAAGG - Intronic
1004293606 6:14390201-14390223 GTCTGTTCCCCAAGCAAAGAGGG + Intergenic
1004504373 6:16236071-16236093 CGCTGGTCCCCAAGCCAGGAGGG + Intergenic
1004549477 6:16632637-16632659 TAGTGCTCCAAAAGCCAGGAGGG + Intronic
1005336002 6:24796915-24796937 GTCTGGTCCCCAAGCAAGGAGGG + Intergenic
1022993603 7:35731817-35731839 GACTGTTCCCCCTGCCTGGAAGG - Intergenic
1023684577 7:42721327-42721349 GACGGATGCACCAGCCAGGAAGG - Intergenic
1025247521 7:57328535-57328557 GACAGAGCCACAAGGCAGGATGG - Intergenic
1026142911 7:67721523-67721545 GACTGTTCCCCAGGCAAGAAGGG + Intergenic
1027496630 7:78895171-78895193 GACTGTTATAAAAGCCAGGCTGG + Intronic
1031975281 7:128089749-128089771 GACTGTTCCACAAGCCAGGAAGG + Intronic
1034984160 7:155497148-155497170 AACTGTTCCACAGTCCTGGAGGG + Intronic
1035496302 7:159329818-159329840 GACTGTCCCACAATCCACAAAGG - Intergenic
1036627033 8:10480590-10480612 GAATGTACCAGAAGCCAGGAGGG + Intergenic
1042806800 8:72779096-72779118 GACTGAGCCACAGGTCAGGAGGG - Intronic
1049066302 8:140318972-140318994 GTCTGTTCCACATGCCAAGCTGG + Intronic
1051768127 9:20546761-20546783 GCCTGTTCCACGGGACAGGATGG - Intronic
1055914884 9:81390937-81390959 GACTCTTCCACAAGCAAGGAGGG - Intergenic
1056615946 9:88165703-88165725 GACACTTCCACAGGCAAGGATGG - Intergenic
1058327145 9:103712958-103712980 CACTTTTCCACAAGTCATGATGG + Intergenic
1059142873 9:111870636-111870658 AACTCATCCACATGCCAGGAGGG + Intergenic
1060187181 9:121570841-121570863 GCCTGTCCCAGAAGCCAGGCCGG - Intronic
1060406312 9:123374744-123374766 GGCTGTTCCTCCAGCCAGGGTGG + Intronic
1062102014 9:134733372-134733394 GACGCTTCCATAGGCCAGGAAGG - Intronic
1185764854 X:2717010-2717032 GACTGAGACATAAGCCAGGAAGG - Intronic
1186075649 X:5875298-5875320 GTGTGTCCCACAAGCCTGGAAGG + Intronic
1191101904 X:56738733-56738755 AACTCATCCACATGCCAGGAGGG - Intergenic
1192872619 X:75199182-75199204 TACTGATACACAAGCCAGGGAGG + Intergenic