ID: 1031976040

View in Genome Browser
Species Human (GRCh38)
Location 7:128094223-128094245
Sequence CAGAGAAAAAACTCAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031976040_1031976048 24 Left 1031976040 7:128094223-128094245 CCCACTTCTGAGTTTTTTCTCTG No data
Right 1031976048 7:128094270-128094292 AGATCAGTCACCAGGCAGGAAGG No data
1031976040_1031976044 -1 Left 1031976040 7:128094223-128094245 CCCACTTCTGAGTTTTTTCTCTG No data
Right 1031976044 7:128094245-128094267 GCCAAGGCTGGTTGAGACAAAGG No data
1031976040_1031976047 20 Left 1031976040 7:128094223-128094245 CCCACTTCTGAGTTTTTTCTCTG No data
Right 1031976047 7:128094266-128094288 GGTCAGATCAGTCACCAGGCAGG No data
1031976040_1031976046 16 Left 1031976040 7:128094223-128094245 CCCACTTCTGAGTTTTTTCTCTG No data
Right 1031976046 7:128094262-128094284 CAAAGGTCAGATCAGTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031976040 Original CRISPR CAGAGAAAAAACTCAGAAGT GGG (reversed) Intergenic
No off target data available for this crispr