ID: 1031976044

View in Genome Browser
Species Human (GRCh38)
Location 7:128094245-128094267
Sequence GCCAAGGCTGGTTGAGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031976040_1031976044 -1 Left 1031976040 7:128094223-128094245 CCCACTTCTGAGTTTTTTCTCTG No data
Right 1031976044 7:128094245-128094267 GCCAAGGCTGGTTGAGACAAAGG No data
1031976038_1031976044 9 Left 1031976038 7:128094213-128094235 CCTGAGCCTTCCCACTTCTGAGT No data
Right 1031976044 7:128094245-128094267 GCCAAGGCTGGTTGAGACAAAGG No data
1031976041_1031976044 -2 Left 1031976041 7:128094224-128094246 CCACTTCTGAGTTTTTTCTCTGC No data
Right 1031976044 7:128094245-128094267 GCCAAGGCTGGTTGAGACAAAGG No data
1031976039_1031976044 3 Left 1031976039 7:128094219-128094241 CCTTCCCACTTCTGAGTTTTTTC No data
Right 1031976044 7:128094245-128094267 GCCAAGGCTGGTTGAGACAAAGG No data
1031976037_1031976044 24 Left 1031976037 7:128094198-128094220 CCAATTGAAATTATGCCTGAGCC No data
Right 1031976044 7:128094245-128094267 GCCAAGGCTGGTTGAGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031976044 Original CRISPR GCCAAGGCTGGTTGAGACAA AGG Intergenic
No off target data available for this crispr