ID: 1031979806

View in Genome Browser
Species Human (GRCh38)
Location 7:128117157-128117179
Sequence CAGATTACACACTCTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031979806_1031979813 5 Left 1031979806 7:128117157-128117179 CCATCCCCAGAGTGTGTAATCTG No data
Right 1031979813 7:128117185-128117207 CCAGGCTATGCCCACAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031979806 Original CRISPR CAGATTACACACTCTGGGGA TGG (reversed) Intergenic
No off target data available for this crispr