ID: 1031981166

View in Genome Browser
Species Human (GRCh38)
Location 7:128126351-128126373
Sequence ATGCTGTGCCCAGTATATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031981166_1031981168 25 Left 1031981166 7:128126351-128126373 CCAATATATACTGGGCACAGCAT No data
Right 1031981168 7:128126399-128126421 GGAGTCTCGCTCTGTCGCCCAGG 0: 20329
1: 57869
2: 114465
3: 140937
4: 148571
1031981166_1031981169 29 Left 1031981166 7:128126351-128126373 CCAATATATACTGGGCACAGCAT No data
Right 1031981169 7:128126403-128126425 TCTCGCTCTGTCGCCCAGGCTGG 0: 26768
1: 89687
2: 191248
3: 194442
4: 151704
1031981166_1031981167 4 Left 1031981166 7:128126351-128126373 CCAATATATACTGGGCACAGCAT No data
Right 1031981167 7:128126378-128126400 TTTTTTTTTTTTTTTTGAGACGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031981166 Original CRISPR ATGCTGTGCCCAGTATATAT TGG (reversed) Intergenic
No off target data available for this crispr