ID: 1031982305

View in Genome Browser
Species Human (GRCh38)
Location 7:128135844-128135866
Sequence GAGGGGGCGCGCGAGCTCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031982291_1031982305 26 Left 1031982291 7:128135795-128135817 CCACGTGCTTCCGGCTGGGGCGG No data
Right 1031982305 7:128135844-128135866 GAGGGGGCGCGCGAGCTCGGCGG No data
1031982293_1031982305 16 Left 1031982293 7:128135805-128135827 CCGGCTGGGGCGGCACCGCGCAG No data
Right 1031982305 7:128135844-128135866 GAGGGGGCGCGCGAGCTCGGCGG No data
1031982301_1031982305 -9 Left 1031982301 7:128135830-128135852 CCGGGAGCGCCCACGAGGGGGCG No data
Right 1031982305 7:128135844-128135866 GAGGGGGCGCGCGAGCTCGGCGG No data
1031982289_1031982305 29 Left 1031982289 7:128135792-128135814 CCTCCACGTGCTTCCGGCTGGGG No data
Right 1031982305 7:128135844-128135866 GAGGGGGCGCGCGAGCTCGGCGG No data
1031982296_1031982305 1 Left 1031982296 7:128135820-128135842 CCGCGCAGTGCCGGGAGCGCCCA No data
Right 1031982305 7:128135844-128135866 GAGGGGGCGCGCGAGCTCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031982305 Original CRISPR GAGGGGGCGCGCGAGCTCGG CGG Intergenic