ID: 1031984117

View in Genome Browser
Species Human (GRCh38)
Location 7:128151468-128151490
Sequence GTATTTTCTTAGTTTAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031984115_1031984117 -1 Left 1031984115 7:128151446-128151468 CCTCACTTTTACATATTTAAAAG No data
Right 1031984117 7:128151468-128151490 GTATTTTCTTAGTTTAAGGATGG No data
1031984113_1031984117 7 Left 1031984113 7:128151438-128151460 CCTTGTACCCTCACTTTTACATA No data
Right 1031984117 7:128151468-128151490 GTATTTTCTTAGTTTAAGGATGG No data
1031984112_1031984117 26 Left 1031984112 7:128151419-128151441 CCATTAACACAGTTCTTCACCTT No data
Right 1031984117 7:128151468-128151490 GTATTTTCTTAGTTTAAGGATGG No data
1031984114_1031984117 0 Left 1031984114 7:128151445-128151467 CCCTCACTTTTACATATTTAAAA No data
Right 1031984117 7:128151468-128151490 GTATTTTCTTAGTTTAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031984117 Original CRISPR GTATTTTCTTAGTTTAAGGA TGG Intergenic
No off target data available for this crispr