ID: 1031984596

View in Genome Browser
Species Human (GRCh38)
Location 7:128155325-128155347
Sequence CCTGGAAGGCAGAGAGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031984586_1031984596 16 Left 1031984586 7:128155286-128155308 CCCAATCACAAGGGACAGGCCAT No data
Right 1031984596 7:128155325-128155347 CCTGGAAGGCAGAGAGGAGAGGG No data
1031984582_1031984596 22 Left 1031984582 7:128155280-128155302 CCCAGCCCCAATCACAAGGGACA No data
Right 1031984596 7:128155325-128155347 CCTGGAAGGCAGAGAGGAGAGGG No data
1031984585_1031984596 17 Left 1031984585 7:128155285-128155307 CCCCAATCACAAGGGACAGGCCA No data
Right 1031984596 7:128155325-128155347 CCTGGAAGGCAGAGAGGAGAGGG No data
1031984583_1031984596 21 Left 1031984583 7:128155281-128155303 CCAGCCCCAATCACAAGGGACAG No data
Right 1031984596 7:128155325-128155347 CCTGGAAGGCAGAGAGGAGAGGG No data
1031984588_1031984596 -3 Left 1031984588 7:128155305-128155327 CCATGCAATCCCGTCTTGTGCCT No data
Right 1031984596 7:128155325-128155347 CCTGGAAGGCAGAGAGGAGAGGG No data
1031984587_1031984596 15 Left 1031984587 7:128155287-128155309 CCAATCACAAGGGACAGGCCATG No data
Right 1031984596 7:128155325-128155347 CCTGGAAGGCAGAGAGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031984596 Original CRISPR CCTGGAAGGCAGAGAGGAGA GGG Intergenic
No off target data available for this crispr