ID: 1031986923

View in Genome Browser
Species Human (GRCh38)
Location 7:128169252-128169274
Sequence CTGTGAGAATGTCTGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031986923_1031986932 8 Left 1031986923 7:128169252-128169274 CCCCCTTCCAGACATTCTCACAG No data
Right 1031986932 7:128169283-128169305 TCCTCTCTTTTTCTAAATCCAGG No data
1031986923_1031986935 21 Left 1031986923 7:128169252-128169274 CCCCCTTCCAGACATTCTCACAG No data
Right 1031986935 7:128169296-128169318 TAAATCCAGGCCTCCTCCGGTGG No data
1031986923_1031986934 18 Left 1031986923 7:128169252-128169274 CCCCCTTCCAGACATTCTCACAG No data
Right 1031986934 7:128169293-128169315 TTCTAAATCCAGGCCTCCTCCGG No data
1031986923_1031986939 27 Left 1031986923 7:128169252-128169274 CCCCCTTCCAGACATTCTCACAG No data
Right 1031986939 7:128169302-128169324 CAGGCCTCCTCCGGTGGAAGGGG No data
1031986923_1031986936 25 Left 1031986923 7:128169252-128169274 CCCCCTTCCAGACATTCTCACAG No data
Right 1031986936 7:128169300-128169322 TCCAGGCCTCCTCCGGTGGAAGG No data
1031986923_1031986938 26 Left 1031986923 7:128169252-128169274 CCCCCTTCCAGACATTCTCACAG No data
Right 1031986938 7:128169301-128169323 CCAGGCCTCCTCCGGTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031986923 Original CRISPR CTGTGAGAATGTCTGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr