ID: 1031988343

View in Genome Browser
Species Human (GRCh38)
Location 7:128178484-128178506
Sequence GTGAGCAGAATGAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031988335_1031988343 20 Left 1031988335 7:128178441-128178463 CCTGCATTGCATTGTATTTTTTC No data
Right 1031988343 7:128178484-128178506 GTGAGCAGAATGAAGGTGGGTGG No data
1031988332_1031988343 29 Left 1031988332 7:128178432-128178454 CCCCAGCAGCCTGCATTGCATTG No data
Right 1031988343 7:128178484-128178506 GTGAGCAGAATGAAGGTGGGTGG No data
1031988339_1031988343 -2 Left 1031988339 7:128178463-128178485 CCAGCTACAGAGGCTCAGGAGGT No data
Right 1031988343 7:128178484-128178506 GTGAGCAGAATGAAGGTGGGTGG No data
1031988333_1031988343 28 Left 1031988333 7:128178433-128178455 CCCAGCAGCCTGCATTGCATTGT No data
Right 1031988343 7:128178484-128178506 GTGAGCAGAATGAAGGTGGGTGG No data
1031988334_1031988343 27 Left 1031988334 7:128178434-128178456 CCAGCAGCCTGCATTGCATTGTA No data
Right 1031988343 7:128178484-128178506 GTGAGCAGAATGAAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031988343 Original CRISPR GTGAGCAGAATGAAGGTGGG TGG Intergenic
No off target data available for this crispr