ID: 1031990634

View in Genome Browser
Species Human (GRCh38)
Location 7:128196654-128196676
Sequence CAAGTCCTTCAGACTACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031990634_1031990638 6 Left 1031990634 7:128196654-128196676 CCAACTGTAGTCTGAAGGACTTG No data
Right 1031990638 7:128196683-128196705 GAGCTTCAACATACATATTTTGG No data
1031990634_1031990640 8 Left 1031990634 7:128196654-128196676 CCAACTGTAGTCTGAAGGACTTG No data
Right 1031990640 7:128196685-128196707 GCTTCAACATACATATTTTGGGG No data
1031990634_1031990642 10 Left 1031990634 7:128196654-128196676 CCAACTGTAGTCTGAAGGACTTG No data
Right 1031990642 7:128196687-128196709 TTCAACATACATATTTTGGGGGG No data
1031990634_1031990641 9 Left 1031990634 7:128196654-128196676 CCAACTGTAGTCTGAAGGACTTG No data
Right 1031990641 7:128196686-128196708 CTTCAACATACATATTTTGGGGG No data
1031990634_1031990639 7 Left 1031990634 7:128196654-128196676 CCAACTGTAGTCTGAAGGACTTG No data
Right 1031990639 7:128196684-128196706 AGCTTCAACATACATATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031990634 Original CRISPR CAAGTCCTTCAGACTACAGT TGG (reversed) Intergenic
No off target data available for this crispr