ID: 1031992320

View in Genome Browser
Species Human (GRCh38)
Location 7:128206457-128206479
Sequence CAGCGCGGAAAGCTGGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031992310_1031992320 18 Left 1031992310 7:128206416-128206438 CCATGCTGGTGGGGGTGGGACCC No data
Right 1031992320 7:128206457-128206479 CAGCGCGGAAAGCTGGCTGTGGG No data
1031992313_1031992320 -3 Left 1031992313 7:128206437-128206459 CCAGCGATCCCAGGAGCAGCCAG No data
Right 1031992320 7:128206457-128206479 CAGCGCGGAAAGCTGGCTGTGGG No data
1031992312_1031992320 -2 Left 1031992312 7:128206436-128206458 CCCAGCGATCCCAGGAGCAGCCA No data
Right 1031992320 7:128206457-128206479 CAGCGCGGAAAGCTGGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031992320 Original CRISPR CAGCGCGGAAAGCTGGCTGT GGG Intergenic
No off target data available for this crispr