ID: 1031997308

View in Genome Browser
Species Human (GRCh38)
Location 7:128241154-128241176
Sequence CCGGCACGTCGCTACCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 16}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031997292_1031997308 27 Left 1031997292 7:128241104-128241126 CCCTCGAGGCCCCGCGAGGTGCA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1031997308 7:128241154-128241176 CCGGCACGTCGCTACCCTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 16
1031997303_1031997308 -6 Left 1031997303 7:128241137-128241159 CCAGGGCTAGCAGCCGCCCGGCA 0: 1
1: 0
2: 0
3: 13
4: 124
Right 1031997308 7:128241154-128241176 CCGGCACGTCGCTACCCTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 16
1031997298_1031997308 16 Left 1031997298 7:128241115-128241137 CCGCGAGGTGCACACTGCGGGCC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1031997308 7:128241154-128241176 CCGGCACGTCGCTACCCTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 16
1031997291_1031997308 30 Left 1031997291 7:128241101-128241123 CCTCCCTCGAGGCCCCGCGAGGT 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1031997308 7:128241154-128241176 CCGGCACGTCGCTACCCTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 16
1031997302_1031997308 -5 Left 1031997302 7:128241136-128241158 CCCAGGGCTAGCAGCCGCCCGGC 0: 1
1: 0
2: 1
3: 9
4: 122
Right 1031997308 7:128241154-128241176 CCGGCACGTCGCTACCCTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 16
1031997295_1031997308 18 Left 1031997295 7:128241113-128241135 CCCCGCGAGGTGCACACTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1031997308 7:128241154-128241176 CCGGCACGTCGCTACCCTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 16
1031997293_1031997308 26 Left 1031997293 7:128241105-128241127 CCTCGAGGCCCCGCGAGGTGCAC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1031997308 7:128241154-128241176 CCGGCACGTCGCTACCCTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 16
1031997297_1031997308 17 Left 1031997297 7:128241114-128241136 CCCGCGAGGTGCACACTGCGGGC 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1031997308 7:128241154-128241176 CCGGCACGTCGCTACCCTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031997308 Original CRISPR CCGGCACGTCGCTACCCTGA GGG Intergenic
1066986884 10:42475937-42475959 CCGGCACGTCGCTCCCCGAGAGG - Intergenic
1073430937 10:103486516-103486538 CCTTCACGTCCCTAGCCTGAGGG - Intergenic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1118399829 14:65369152-65369174 GCGGCAAGTGGCTACCCTGTGGG + Intergenic
1145057959 17:19715414-19715436 CCTCCACGTCCCTACCCAGAAGG + Intronic
1150487494 17:65554069-65554091 CCGGCACCTCCTTTCCCTGAAGG - Intronic
1164624134 19:29715299-29715321 CCGGCGCGTGGCTTCCCGGAAGG - Intronic
1167414125 19:49361549-49361571 CCGGCAAGCCCCTCCCCTGATGG - Intronic
944130064 2:196338059-196338081 CAGGCATGCTGCTACCCTGAGGG - Intronic
1170452691 20:16501378-16501400 CCGGCACTTCTATACACTGATGG + Intronic
1182463657 22:30500822-30500844 CAGGCACATCCCTGCCCTGATGG + Intronic
954707663 3:52489615-52489637 CCGGCACGTCGCCAGCCTGCGGG + Exonic
962688448 3:137869346-137869368 CCAGGACCTCGCTACCCTGAAGG + Intergenic
972150342 4:36081722-36081744 CCTACACCTCTCTACCCTGAGGG - Intronic
994747540 5:103697469-103697491 TTGGCACGTCACTTCCCTGATGG - Intergenic
999679118 5:154038925-154038947 CCGGCACGCCTCTGCGCTGAAGG - Intronic
1002648506 5:180674149-180674171 CCGGTTCCTCGCCACCCTGATGG - Intergenic
1031997308 7:128241154-128241176 CCGGCACGTCGCTACCCTGAGGG + Intergenic
1032525858 7:132577633-132577655 CCCGCACGGAGCTACCCTGGCGG + Intronic
1190917385 X:54820865-54820887 CAGGCAAGTCGCTGCCCTGATGG - Intergenic