ID: 1031997660

View in Genome Browser
Species Human (GRCh38)
Location 7:128243239-128243261
Sequence TGCTCAGTTTGTTAGCTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031997657_1031997660 14 Left 1031997657 7:128243202-128243224 CCTCGTTGCTTAGCAGACAGCAT 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1031997660 7:128243239-128243261 TGCTCAGTTTGTTAGCTCTATGG 0: 1
1: 0
2: 1
3: 8
4: 132
1031997656_1031997660 22 Left 1031997656 7:128243194-128243216 CCAATGTGCCTCGTTGCTTAGCA 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1031997660 7:128243239-128243261 TGCTCAGTTTGTTAGCTCTATGG 0: 1
1: 0
2: 1
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031997660 Original CRISPR TGCTCAGTTTGTTAGCTCTA TGG Intronic
902452859 1:16509134-16509156 TGTTCAGTTTGGTGGCTCTCTGG - Intergenic
902472917 1:16661813-16661835 TGTTCAGTTTGGTGGCTCTCTGG - Intergenic
902485886 1:16745627-16745649 TGTTCAGTTTGGTGGCTCTCTGG + Intronic
902499622 1:16901082-16901104 TGTTCAGTTTGGTGGCTCTCTGG + Intronic
908550290 1:65201902-65201924 TGCTCATATTTTTAGCTCCAGGG - Intronic
910461416 1:87451618-87451640 TATTCAGGTTGTTATCTCTATGG - Intergenic
910766618 1:90788868-90788890 TGCTCCCTTTGTTAGATTTATGG + Intergenic
912196769 1:107406786-107406808 AGCTCAGTTTTTTACCTCTTAGG - Intronic
913319519 1:117578550-117578572 GGCTCAGTTTGTTAGATGAATGG + Intergenic
917752045 1:178062556-178062578 TGCTTAGTTTGTTTGGTCTGGGG - Intergenic
918320658 1:183361039-183361061 TGCTCAGTGTGGTAGCTCTGAGG - Intronic
919158658 1:193800955-193800977 TGGTGTGTTAGTTAGCTCTAGGG - Intergenic
919459532 1:197859922-197859944 TGCTAAGTATGTAAGCTCTGAGG - Intergenic
919760680 1:201096195-201096217 TCCTCAGCCTGTTAGCTCCAAGG + Intronic
920861743 1:209714433-209714455 TGCAAAATTTGTTAGCTCCAGGG - Intronic
923363054 1:233231709-233231731 TGCTGAGTTTGATAGCTGTTAGG - Intronic
1062786948 10:272566-272588 TGCCCAGCTTGCTTGCTCTAGGG - Intergenic
1063324274 10:5081613-5081635 TGCTTAGTTGGTTGGCTTTATGG - Intronic
1067041434 10:42955259-42955281 TGCTCAGTTTAGGGGCTCTAGGG - Intergenic
1067152095 10:43744836-43744858 TGCTGAGTTTTTTTGATCTATGG + Intergenic
1068513257 10:57993261-57993283 TGCTCACTTTGTGAGGTCTTAGG - Intergenic
1071284274 10:84129863-84129885 TGATGAGTTTGTTAGCTATTAGG - Intergenic
1072300620 10:94058047-94058069 TTTTCAGTTTGTTAGCTATGTGG + Intronic
1072852723 10:98913635-98913657 TGCTCATTTTGGTAGCTTTTAGG - Intronic
1073030519 10:100521882-100521904 TGCTCAGTTTTATATCTCCAGGG + Intronic
1076012498 10:127001741-127001763 CACTCCGTTAGTTAGCTCTATGG - Intronic
1076104247 10:127807861-127807883 TTCTCATATTGTGAGCTCTAAGG - Intergenic
1080178669 11:29396566-29396588 GTCTCAGTTTGTTATCTCTTTGG - Intergenic
1081027907 11:38038218-38038240 TGCTCCCTTTGTAGGCTCTAGGG - Intergenic
1086768214 11:90726727-90726749 TGCTCAGTTTATAACTTCTAAGG - Intergenic
1088299713 11:108344050-108344072 TGCTCTGTTTATTAGCTCACTGG - Intronic
1090112014 11:123922277-123922299 TGCTCAATTTGCTAACCCTATGG - Intergenic
1090749125 11:129730665-129730687 TGCACATTTTGTTAGCTCTCTGG - Intergenic
1090968902 11:131622797-131622819 TGCTCAGCTTGTTAGCTCAAGGG - Intronic
1093742585 12:22705339-22705361 TGCTCATCATGTTAGCCCTAGGG - Intergenic
1095729847 12:45494484-45494506 TCCTCAGTTTTCTAGCTGTAAGG + Intergenic
1097694963 12:62766994-62767016 TGCTCAGTTGGTTAGGGCTGTGG + Intronic
1099277715 12:80599095-80599117 TGCTGAGTGTGTTAGCTCAAAGG - Intronic
1100109573 12:91223059-91223081 TGCTCATTTTGTAAACTCTGGGG - Intergenic
1106051900 13:26198532-26198554 TATTAAGTATGTTAGCTCTAGGG - Intronic
1106296198 13:28416037-28416059 TGCTAAGTTTGTTTGCTGAAAGG - Intronic
1107078969 13:36353890-36353912 TGTTCAGTTGGTTAACTCCAAGG + Intronic
1107100467 13:36585221-36585243 TGCTTATTTTGTTAGCTATTGGG + Intergenic
1111849785 13:93558291-93558313 TGCTCACTTTCTTACCTATAAGG + Intronic
1112971240 13:105265836-105265858 TGTACAGTTTGTTGGCACTAGGG - Intergenic
1117661649 14:58012506-58012528 TTCTCAGTTTGTAAGCTCAGTGG + Intronic
1118344888 14:64931078-64931100 TGCTAAGTTTGCTAGCTGTCTGG - Intronic
1118599293 14:67460332-67460354 TCCTCAGTTTGTTATCTGTGAGG + Intronic
1118923995 14:70174863-70174885 CGCTCAGGTTGGTGGCTCTACGG + Intronic
1123768848 15:23509082-23509104 TCCTCAGTTTCTTAGCTGAAAGG - Intergenic
1126817233 15:52466064-52466086 TGCTCCGCATGTTAGATCTAGGG - Intronic
1131656613 15:94467189-94467211 TGCAACTTTTGTTAGCTCTATGG - Intronic
1131714874 15:95097600-95097622 TGCTCAGTTTATTAGTCATATGG + Intergenic
1136706709 16:32195593-32195615 TGTTTAGTGTGGTAGCTCTATGG + Intergenic
1136761202 16:32733824-32733846 TGTTTAGTGTGGTAGCTCTATGG - Intergenic
1136806901 16:33136562-33136584 TGTTTAGTGTGGTAGCTCTATGG + Intergenic
1137921630 16:52494827-52494849 TTTTCAGTTTGTTTGCTCTTTGG + Intronic
1139000557 16:62505510-62505532 TCCTCAGTTGAATAGCTCTATGG - Intergenic
1203063355 16_KI270728v1_random:994141-994163 TGTTTAGTGTGGTAGCTCTATGG - Intergenic
1142761525 17:2044806-2044828 TGCTCAGTTGCTTAGCTCCCTGG - Intergenic
1145721081 17:27073401-27073423 TCCTCAGTTTGTTTTCTCTCTGG - Intergenic
1147235194 17:39051813-39051835 TGCTGAATCTGTTAGCTCTGGGG + Intergenic
1149939370 17:60846698-60846720 TGCTTATTTTCTTAGCTCCAAGG + Intronic
1151088941 17:71413100-71413122 TGCTCAGTTTATTTTCTCTGTGG + Intergenic
1156963204 18:43057969-43057991 TGCTTTGTTTGTTCACTCTATGG - Intronic
1159999600 18:75004146-75004168 TGCTCAGTTTGTGTGCGCCATGG + Intronic
1160487231 18:79304689-79304711 TGCTCAGTGTGGTGGCTCTGAGG - Intronic
1164751541 19:30658973-30658995 TGGGCAGTTTGTCAGCTCTCAGG + Intronic
1166169748 19:41019407-41019429 TGCTCTGTTTGTTATTTCTGTGG - Intergenic
925628367 2:5864567-5864589 TGCTCTCTCTGTCAGCTCTAGGG - Intergenic
925985187 2:9209072-9209094 TGCTCAGTAACTGAGCTCTAGGG - Intronic
931368272 2:61638275-61638297 TGCTCACTTTGTTCTCTCTCTGG - Intergenic
932047041 2:68360085-68360107 TGCTCAGTCAGTTGGCTCTTTGG + Intergenic
932338730 2:70946109-70946131 TGCTCAGCATGTTTGCTCAAAGG + Intronic
932579523 2:72984443-72984465 TGCTCAGTTTCTCAGCTATATGG + Intronic
937475041 2:122207764-122207786 AGCTAAGTTTGTTAGCTTTGTGG - Intergenic
937766794 2:125670717-125670739 TGCTCCTATTGATAGCTCTATGG - Intergenic
938078620 2:128356154-128356176 GGCTAAATTTGTTAACTCTATGG + Intergenic
941913768 2:170793861-170793883 TGCTGAGTTTCTTAACTCTGTGG + Intronic
942807084 2:179943864-179943886 TGCTCAGCTTGTAAGTTCTGTGG + Intergenic
943857186 2:192811320-192811342 TGCTTAGTTTCTTATGTCTATGG + Intergenic
944286256 2:197953121-197953143 TTCTCTGTATGTTATCTCTAAGG - Intronic
944948432 2:204717885-204717907 TTCTCAGTTTGTATGCTCCATGG + Intronic
945150244 2:206783350-206783372 TCCTCAGTTGGTAAGCTCTCCGG + Intronic
946061148 2:216942589-216942611 GGCTCAGGTTGTTGACTCTAAGG + Intergenic
947535954 2:230940601-230940623 TGCCCTGTTTGTGAGCTCTCAGG + Intronic
1174790326 20:53472164-53472186 AGCTCACTTTGTTTGCTATATGG + Intronic
1178918258 21:36721743-36721765 TGCACAGTATGTTAACTGTATGG + Intronic
1182890469 22:33814257-33814279 TGCTCAGTGTCTTAGCTTTAGGG - Intronic
949284527 3:2385570-2385592 TGCTCCGTCTGTAACCTCTAGGG + Intronic
952497386 3:33927966-33927988 TGCTCAGTGTTTTTGCTCTGGGG + Intergenic
953019205 3:39103277-39103299 TGCTCAGCTTCTGAGCTCTGTGG - Intronic
953511638 3:43546924-43546946 TGCTCAGCTTCTTAGATCTGTGG - Intronic
956953009 3:74303754-74303776 TGCTCTGTTAATTAGCTCTTGGG - Intronic
958650752 3:96932692-96932714 TGCTCAGTTTGCTAACTCTCCGG - Intronic
959014538 3:101118625-101118647 TTCTCAGTTCATTAGCTCTTTGG - Intergenic
959588733 3:108052452-108052474 TCTTTAGTTTGTTAGCTCTTTGG - Intronic
963194822 3:142515361-142515383 TGTTCAGTTTGTTAACTGAATGG - Intronic
964563031 3:158019386-158019408 TGCTCAGTTAGTTCAGTCTAAGG + Intergenic
964799463 3:160539099-160539121 TGCTCAGTTCCTTACCTCTATGG + Intronic
965146252 3:164908536-164908558 TTCTCAGATTCATAGCTCTAAGG - Intergenic
974232091 4:59129967-59129989 TGTTCAGTTTGATAGTTTTATGG + Intergenic
974464483 4:62237167-62237189 TGCTCAGTCCGTGAGCTCTGGGG - Intergenic
975288106 4:72644309-72644331 TGCTGAGATTGCTAGCTGTAAGG + Intergenic
981667914 4:147250819-147250841 TGATTAGTTTGTTAGCTTAATGG - Intergenic
984489981 4:180421634-180421656 TGCTGGGTTTGTTAGCTGAAAGG + Intergenic
985627296 5:995682-995704 TGCTGAGGTTGTGAGCTCCAGGG + Intergenic
988184403 5:27841615-27841637 TCCTCATTTTGTTAGTTATACGG - Intergenic
992573637 5:78087560-78087582 TGATCATTTTGTTAGCTTTTGGG + Intronic
993995807 5:94721156-94721178 TGCTCAAGATTTTAGCTCTATGG - Intronic
995976074 5:118036107-118036129 TACACAGTTTGTTAGTTCCATGG + Intergenic
997579274 5:135007052-135007074 TGCCTTGTTTCTTAGCTCTAAGG + Intronic
998269723 5:140695654-140695676 AGCACAGTTTGATAGTTCTAGGG + Intronic
998720815 5:144946606-144946628 TGCTCAGTCTCTTAGATCTGAGG - Intergenic
998725100 5:145003784-145003806 TTCCCAGTTTAATAGCTCTATGG - Intergenic
1007368335 6:41409689-41409711 AGCTCAGTTTCCTATCTCTAAGG - Intergenic
1009192618 6:60647889-60647911 TGTTCAGATTGTTGGCTCTAGGG - Intergenic
1015463246 6:133517699-133517721 AGCTTAGTTTGTCAGTTCTAGGG + Intronic
1016235117 6:141855051-141855073 TGCTCTGGTTGTTTGGTCTAGGG - Intergenic
1017074588 6:150606003-150606025 TCCTCTGTTTCTTAGCTCTGGGG + Intronic
1017302481 6:152878842-152878864 TGCTGAGTTTAAGAGCTCTAGGG + Intergenic
1020582671 7:10024714-10024736 TGCTTAGTTTGTTACCTATGTGG - Intergenic
1024020029 7:45360252-45360274 GGCTCAGTGTGTTTTCTCTAAGG - Intergenic
1026378819 7:69778727-69778749 TGATGAGTTTGTGAGCTCTTAGG + Intronic
1031997660 7:128243239-128243261 TGCTCAGTTTGTTAGCTCTATGG + Intronic
1033191476 7:139284342-139284364 TGATGAGTTTGTTAGCTTTGAGG - Exonic
1035162303 7:156960208-156960230 TGGCCAGTTTGTGAGCTTTAGGG - Intronic
1038121287 8:24619212-24619234 TGATCTTTTTATTAGCTCTATGG - Intergenic
1040720466 8:50315203-50315225 TCTTCAGTTTGTTATGTCTATGG + Intronic
1043274090 8:78371750-78371772 CTCTCAGTTTGTCAGCTCTGTGG - Intergenic
1043704558 8:83331889-83331911 TGCTCAGGGTGTTAGATCAAAGG - Intergenic
1047366208 8:124213991-124214013 TGCTATTTTTGTTAGATCTAAGG - Intergenic
1056649593 9:88446932-88446954 TGTTGAGCTTGTTAGCTCTGTGG + Intronic
1186490586 X:9969282-9969304 TGCTCAGTTTTTTACATATATGG - Intergenic
1186514282 X:10154714-10154736 TGCTAAGGGTGTTATCTCTAGGG - Intergenic
1186517336 X:10175729-10175751 TGAACACTTTGTTAGCGCTATGG + Intronic
1187364459 X:18655117-18655139 TCCTCAGTGTGTGAGCTCTTAGG + Intronic
1189233502 X:39470337-39470359 TCCTCACTTTGATGGCTCTAGGG + Intergenic
1189669979 X:43397812-43397834 TGATGAGTTTGTAATCTCTAGGG + Intergenic
1192180875 X:68914787-68914809 GGCTCTGTTTGTTTGCTCTGTGG - Intergenic
1197097644 X:122614294-122614316 TCCTCAGTTTCTTAGCTGAAAGG + Intergenic
1197986258 X:132269309-132269331 TGCTCAAGTTGTTAGCACTGTGG + Intergenic