ID: 1031998035

View in Genome Browser
Species Human (GRCh38)
Location 7:128245754-128245776
Sequence GCTGCTCTTTAGATCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031998035_1031998040 -6 Left 1031998035 7:128245754-128245776 CCAGCCTGGATCTAAAGAGCAGC 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1031998040 7:128245771-128245793 AGCAGCAGATGGGCCAGGCTCGG 0: 1
1: 0
2: 3
3: 81
4: 642
1031998035_1031998046 28 Left 1031998035 7:128245754-128245776 CCAGCCTGGATCTAAAGAGCAGC 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1031998046 7:128245805-128245827 TGTAATCCCAGCATTTTGGGAGG No data
1031998035_1031998043 24 Left 1031998035 7:128245754-128245776 CCAGCCTGGATCTAAAGAGCAGC 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1031998043 7:128245801-128245823 TGCCTGTAATCCCAGCATTTTGG 0: 4987
1: 103398
2: 243056
3: 299803
4: 254654
1031998035_1031998044 25 Left 1031998035 7:128245754-128245776 CCAGCCTGGATCTAAAGAGCAGC 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1031998044 7:128245802-128245824 GCCTGTAATCCCAGCATTTTGGG No data
1031998035_1031998041 -3 Left 1031998035 7:128245754-128245776 CCAGCCTGGATCTAAAGAGCAGC 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1031998041 7:128245774-128245796 AGCAGATGGGCCAGGCTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031998035 Original CRISPR GCTGCTCTTTAGATCCAGGC TGG (reversed) Intronic