ID: 1031998035

View in Genome Browser
Species Human (GRCh38)
Location 7:128245754-128245776
Sequence GCTGCTCTTTAGATCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031998035_1031998040 -6 Left 1031998035 7:128245754-128245776 CCAGCCTGGATCTAAAGAGCAGC 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1031998040 7:128245771-128245793 AGCAGCAGATGGGCCAGGCTCGG 0: 1
1: 0
2: 3
3: 81
4: 642
1031998035_1031998046 28 Left 1031998035 7:128245754-128245776 CCAGCCTGGATCTAAAGAGCAGC 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1031998046 7:128245805-128245827 TGTAATCCCAGCATTTTGGGAGG 0: 13476
1: 310447
2: 266634
3: 201224
4: 222235
1031998035_1031998043 24 Left 1031998035 7:128245754-128245776 CCAGCCTGGATCTAAAGAGCAGC 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1031998043 7:128245801-128245823 TGCCTGTAATCCCAGCATTTTGG 0: 4987
1: 103398
2: 243056
3: 299803
4: 254654
1031998035_1031998044 25 Left 1031998035 7:128245754-128245776 CCAGCCTGGATCTAAAGAGCAGC 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1031998044 7:128245802-128245824 GCCTGTAATCCCAGCATTTTGGG 0: 9429
1: 235524
2: 277870
3: 222838
4: 263838
1031998035_1031998041 -3 Left 1031998035 7:128245754-128245776 CCAGCCTGGATCTAAAGAGCAGC 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1031998041 7:128245774-128245796 AGCAGATGGGCCAGGCTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031998035 Original CRISPR GCTGCTCTTTAGATCCAGGC TGG (reversed) Intronic
900636558 1:3668997-3669019 GCTGCCCTGCAGCTCCAGGCCGG + Intronic
901036435 1:6338820-6338842 GCTTCTTTTTATACCCAGGCTGG - Intronic
901971657 1:12913419-12913441 GCTTGTCTTTGGATCCAGGATGG + Intronic
902013510 1:13288321-13288343 GCTTGTCTTTGGATCCAGGATGG - Intergenic
902663326 1:17920494-17920516 GCTGCTCTTTTGCTCCAGGAGGG + Intergenic
903940393 1:26926044-26926066 CCCGCTCTTTTTATCCAGGCTGG + Intronic
904199289 1:28809250-28809272 TCTGCTCTTTTCACCCAGGCTGG + Intergenic
907275351 1:53313931-53313953 GCTGCTGCTGAGATCCAGGAAGG + Intronic
912574437 1:110652900-110652922 GATCCTCTTTAGATCCAGAATGG - Intergenic
915745803 1:158156549-158156571 CTTGCTCTTGACATCCAGGCTGG - Intergenic
918177973 1:182061754-182061776 GCTGCTCTCTGGATGCAGGCAGG - Intergenic
920116090 1:203622942-203622964 CCTGTTCTTTAGATCTAGCCTGG - Intergenic
920590446 1:207212974-207212996 TCAGCTATTGAGATCCAGGCAGG + Intergenic
1063880116 10:10522597-10522619 GCTGCTCTTATTGTCCAGGCTGG + Intergenic
1063975034 10:11408262-11408284 GCTGCTTCTTGGAGCCAGGCTGG + Intergenic
1064146575 10:12830651-12830673 GCTGCCCTGTAAAGCCAGGCAGG + Exonic
1064454960 10:15478670-15478692 GCGGCTCTCCAGATCCTGGCCGG + Intergenic
1067188326 10:44049123-44049145 TCTGATTTTTAGTTCCAGGCAGG + Intergenic
1068197520 10:53736421-53736443 TTTGCTCTTGTGATCCAGGCTGG - Intergenic
1068389772 10:56379958-56379980 GTTGCTCTTCAGATGCAAGCTGG + Intergenic
1072618874 10:97067058-97067080 CCAGATCTTTAGCTCCAGGCAGG + Intronic
1073792744 10:106956341-106956363 GCTGGGCTTTATCTCCAGGCAGG - Intronic
1073875547 10:107917794-107917816 GCTGCTCTGGTGCTCCAGGCAGG - Intergenic
1075709113 10:124521299-124521321 GCTGCTCCATAGAGCCTGGCTGG - Intronic
1077423568 11:2464045-2464067 GCTGCCCGGTGGATCCAGGCAGG + Intronic
1080032510 11:27676915-27676937 TGTGCTCTTTAGATCCAGCATGG + Intronic
1083268541 11:61558770-61558792 TCTGCTCTTTTCACCCAGGCTGG + Intronic
1084162126 11:67355634-67355656 GCTGCTCTGTAGATGTTGGCTGG + Intronic
1084698030 11:70768024-70768046 GATCCCCTTTAGATCCAAGCTGG + Intronic
1085255989 11:75173439-75173461 ACTGATCTTCAGATCCAGCCTGG - Intronic
1088358409 11:108966909-108966931 GGTGCGCTTTAGAACCAGGTGGG + Intergenic
1090205254 11:124880271-124880293 GCTGCTCCTCAGCCCCAGGCTGG + Intronic
1090359626 11:126163442-126163464 GCAGCTCCTGAGACCCAGGCTGG + Intergenic
1091339306 11:134798049-134798071 CCTGCTCTTTAGACCCATGCAGG - Intergenic
1096816519 12:54205210-54205232 GCTGCCCATTAGAATCAGGCAGG + Intergenic
1100338545 12:93656018-93656040 CCAGCTCTGTAGGTCCAGGCAGG - Intergenic
1102615100 12:114146701-114146723 CCTGTTCCTTAGATCCAGGGAGG + Intergenic
1102768205 12:115451411-115451433 GCTGTTCTGTAGGACCAGGCTGG - Intergenic
1103508437 12:121456787-121456809 ACTGCTGTTGAGGTCCAGGCAGG - Intronic
1103531529 12:121605685-121605707 GCTGGTCTTGAACTCCAGGCTGG + Intergenic
1105893912 13:24702120-24702142 GCAGCTCTTTAGAGCCAGTGGGG - Intronic
1106441281 13:29774504-29774526 GCTATTCTTTATAGCCAGGCAGG - Intronic
1107853615 13:44593368-44593390 GGTGCTCTTGTCATCCAGGCTGG - Intergenic
1111301328 13:86354379-86354401 TCTGCTCTTAAGAGTCAGGCAGG - Intergenic
1113740694 13:112710634-112710656 GCTGCTCTCTGGTTCCAGGGAGG + Intronic
1115164956 14:30437760-30437782 GCTGCTCTGGAGATTGAGGCAGG + Intergenic
1120736425 14:88057950-88057972 GCTGCTCTTTCTGTCCAAGCAGG + Intergenic
1121900373 14:97688372-97688394 GCTGCTCTTGGGACCCAGCCTGG + Intergenic
1122113044 14:99514920-99514942 GCTGCTTCTGAGATCCAGCCTGG - Exonic
1122382767 14:101321416-101321438 GGTGCTCTTTTGACCCAGGTGGG - Intergenic
1122789104 14:104176894-104176916 GCTGCTCCTCTGCTCCAGGCTGG - Exonic
1122932779 14:104942372-104942394 GCTGATCTGGAGGTCCAGGCTGG - Exonic
1202882094 14_KI270722v1_random:70031-70053 GCTGACCTGTAGATACAGGCAGG + Intergenic
1123908736 15:24945801-24945823 GCTGCTCCCTAGATTGAGGCGGG + Intronic
1125542339 15:40476791-40476813 TCCTCTCTTTAGAGCCAGGCAGG - Intergenic
1125933922 15:43618435-43618457 CCTCATCTTTAGATCCAGGTAGG - Intronic
1125947019 15:43717897-43717919 CCTCATCTTTAGATCCAGGTAGG - Intergenic
1127905433 15:63372716-63372738 GCTCCTCCTTAGGTCCTGGCTGG - Intronic
1128237216 15:66076621-66076643 GCTGCTCCTGAGAGGCAGGCTGG + Intronic
1128744110 15:70101726-70101748 GCTGCTCTGTAAATCCAGGCCGG - Intergenic
1131712961 15:95075604-95075626 GCTGCACTTTGGATTCAGTCTGG - Intergenic
1132472071 16:110457-110479 GCTGCTCCTCAGGCCCAGGCAGG + Intronic
1132912397 16:2321237-2321259 GCTTCTCCTGAGCTCCAGGCTGG + Intronic
1133446195 16:5863027-5863049 GCTGCCTTTGAGACCCAGGCAGG - Intergenic
1134363266 16:13552636-13552658 GCTGCTATTTAAAGCCAGGTTGG + Intergenic
1135534133 16:23279758-23279780 GCAGCTCTTTAAACCCAGCCAGG + Intronic
1136358417 16:29761694-29761716 GCTGCTCTGTAGACTGAGGCAGG + Intergenic
1138511459 16:57510801-57510823 ACTGCTCTTTGGGGCCAGGCTGG + Intergenic
1140456011 16:75106010-75106032 GCTGTTCTTTTGACCCAGGAAGG + Intronic
1144799285 17:17913999-17914021 GCTACTCTTTTGAGCCAGGAAGG - Intronic
1144812565 17:18010019-18010041 GCTGCTCTGAACATCCACGCGGG + Intronic
1147980075 17:44268685-44268707 CCAGCTCTTTAGAACCAGCCAGG - Intergenic
1149605143 17:57919207-57919229 TCTGCTCTTGTCATCCAGGCTGG + Intronic
1150245166 17:63669291-63669313 GCTATTCTTCAGGTCCAGGCTGG + Intronic
1151019772 17:70601607-70601629 GTTGCTCATGAGTTCCAGGCAGG - Intergenic
1152485225 17:80586649-80586671 GCTGCTCTTCAGTTCCCGCCTGG - Intronic
1155532193 18:26778406-26778428 GCTGCATTTCAGAACCAGGCAGG - Intergenic
1156731697 18:40201794-40201816 GTTGCATTTTAGATACAGGCAGG + Intergenic
1159605079 18:70466585-70466607 GCTTCTCTCTTGATCCATGCAGG - Intergenic
1160887554 19:1357903-1357925 GCAGCTCTGAAGATGCAGGCAGG - Intronic
1163821261 19:19497843-19497865 TCTGCTCCTGGGATCCAGGCAGG + Intronic
1165157357 19:33796544-33796566 GCTGCCCTTTACGTCCGGGCTGG + Intronic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1168599134 19:57704132-57704154 TCTGCTCTTAACATCCAGCCTGG - Intronic
1202657708 1_KI270708v1_random:39129-39151 GCTGACCTATAGATACAGGCAGG + Intergenic
926426073 2:12739631-12739653 GCCTCTCTTTAGGACCAGGCAGG - Intronic
929517342 2:42615830-42615852 GCTACTCTGGAGATTCAGGCAGG - Intronic
932703963 2:74009326-74009348 GTTGGTCTATGGATCCAGGCAGG - Intronic
933181857 2:79235994-79236016 TCTGCTCCTCAGAGCCAGGCAGG - Intronic
933865067 2:86508730-86508752 GGTGCTAGTTAGATTCAGGCAGG - Intronic
936018875 2:108979848-108979870 GCTGCCCGTCAGAGCCAGGCTGG - Intronic
936291607 2:111228532-111228554 GCAGCTCGTTATCTCCAGGCAGG - Intergenic
936392803 2:112090638-112090660 GCTGGTCTTGAGTTCCTGGCTGG + Intronic
937925099 2:127162123-127162145 GCTGCTCTGCAGCCCCAGGCTGG + Intergenic
938634571 2:133209524-133209546 GATGGACTTTGGATCCAGGCTGG + Intronic
939563070 2:143754499-143754521 GCTGCTTTGTATATCTAGGCAGG - Intronic
939959602 2:148554653-148554675 GCTGCTCTTTCTCCCCAGGCAGG + Intergenic
941259202 2:163274749-163274771 TCTGCCCTTTAGCTCCAGGAAGG - Intergenic
947596706 2:231417297-231417319 CCTGCTCTGTCGAACCAGGCTGG + Intergenic
947983549 2:234429540-234429562 GCTGAGCTGGAGATCCAGGCAGG + Intergenic
1170633583 20:18085622-18085644 GCTGCTCTTTACTTCCAAGATGG - Intergenic
1171074173 20:22105208-22105230 CTTGCTCTTTTCATCCAGGCTGG + Intergenic
1172629091 20:36366369-36366391 GCTGATTTAAAGATCCAGGCAGG + Intronic
1172943600 20:38671508-38671530 GGTGGTCCTTAGATCCAGGAAGG - Intergenic
1172979550 20:38930675-38930697 GTTGCTCTTTTGGCCCAGGCTGG + Intronic
1175298722 20:57927836-57927858 GCTGCAGGTGAGATCCAGGCTGG + Intergenic
1175684493 20:61017699-61017721 GCTACTCTCTAGAGCCAGGATGG - Intergenic
1175700302 20:61131967-61131989 GCTGGTCTTTATCTCCAGGGTGG + Intergenic
1176034976 20:63031750-63031772 GCTGGTCGTTGGGTCCAGGCAGG + Intergenic
1177996873 21:28111258-28111280 GCTGCTCTGTAGCTCCACGTGGG + Intergenic
1179623117 21:42631903-42631925 GCTGCTCATTAGATTCACGTGGG + Intergenic
1180173425 21:46073973-46073995 GCTGGTCTTAAACTCCAGGCTGG + Intergenic
1181442002 22:22941577-22941599 GCTGCTCTGGAGATCTAGGGAGG + Intergenic
1181939495 22:26464303-26464325 GCTGCTCTTGGGCTCCATGCTGG + Exonic
1184279740 22:43430169-43430191 GGTGCTCTGAAGGTCCAGGCAGG - Intronic
950274413 3:11646399-11646421 GCTGCACATTAGAACCAGGGGGG + Intronic
950788583 3:15455027-15455049 CCTGCTCTAAAGATCCAGGCTGG - Intronic
953457259 3:43053234-43053256 GTTGCTCTTTAGCTCTAGCCTGG - Intronic
954372783 3:50177372-50177394 GCTGCTCCTGAGACCCCGGCAGG - Intronic
954469344 3:50678669-50678691 CCTGCTCTTGTCATCCAGGCTGG + Intronic
954540199 3:51388553-51388575 GCTGCTCTTTGGCACCAGCCTGG + Intronic
956417812 3:69051882-69051904 GCTGTTCTCTTGATGCAGGCAGG - Intronic
956861408 3:73327523-73327545 GCTGCATTTTAGAGACAGGCTGG - Intergenic
957346817 3:78971875-78971897 GCTGCTCTGGAGATTGAGGCAGG - Intronic
961163310 3:124747706-124747728 GCAGCTCTCTGGATCCAGCCTGG + Intergenic
963081660 3:141400870-141400892 GCTGGGCTTTAAACCCAGGCAGG + Intronic
963842733 3:150124154-150124176 GCTGCTCTCTAGACCATGGCAGG + Intergenic
970657066 4:18242940-18242962 GCTGCTCTTTAAAGTCAGACAGG - Intergenic
972451475 4:39204113-39204135 TTTGCTCTTTTTATCCAGGCTGG + Intronic
973619632 4:52713338-52713360 GCTCCTCTTTGGATCCTGTCTGG + Intergenic
973768156 4:54182604-54182626 TTTGCTCTTTTCATCCAGGCTGG + Intronic
973825099 4:54696883-54696905 GCTGTTCTTTACATTCAGGAAGG + Intronic
976147224 4:82053783-82053805 GCATCTCTTTATATTCAGGCTGG + Intergenic
976189302 4:82473766-82473788 GCTGCACTTCAGATCCAGTGAGG + Intergenic
978768068 4:112425073-112425095 GCTGCTCCTTTGATTCAGGCAGG - Intronic
983251629 4:165352193-165352215 GCTGCTCTGTCCATCCAAGCGGG + Intergenic
985588003 5:750889-750911 GCTGCTCTGTAGATGCTGCCAGG - Intronic
985602672 5:843356-843378 GCTGCTCTGTAGATGCTGCCAGG - Intronic
989975752 5:50585007-50585029 GCTGCTCTGTAACTCCAGGTAGG - Intergenic
990979701 5:61591619-61591641 TTTGCTCTTTTTATCCAGGCTGG - Intergenic
994388427 5:99160408-99160430 GATGCTCTATGGATCAAGGCAGG + Intergenic
996800441 5:127396980-127397002 GCTGACCCTTAGATTCAGGCTGG - Intronic
998117039 5:139546071-139546093 TCTGCTCTTGTGACCCAGGCTGG + Intronic
1001204495 5:169749655-169749677 TATGGTCTTTAGAGCCAGGCAGG - Intronic
1001426964 5:171629172-171629194 CCTGCTCTTTAGACGTAGGCAGG - Intergenic
1001941819 5:175745425-175745447 GATGCTCTGCTGATCCAGGCTGG - Intergenic
1003102502 6:3187727-3187749 GCTGCTCTTGAGTTCCTGGGTGG - Intergenic
1006639125 6:35479977-35479999 GCTGCTCTGTGGCTCCAGCCTGG - Intronic
1006953967 6:37850219-37850241 GAAGCTCTTTAGAGCCAGTCAGG + Intronic
1008076209 6:47148771-47148793 TTTGCTCTTTTCATCCAGGCTGG + Intergenic
1010518538 6:76803686-76803708 GCTGCTCTGTCTATCCAAGCAGG + Intergenic
1010663459 6:78598494-78598516 TCTGCTCTGTGGAGCCAGGCAGG + Intergenic
1011366251 6:86585369-86585391 GCTGCTCTGTATATCCAAGTGGG + Intergenic
1018913836 6:168120808-168120830 GCTGCTGTTCAGATCCTGTCTGG + Intergenic
1019196476 6:170286269-170286291 GCTGCTCATCACATCCAGGCAGG + Exonic
1021012341 7:15485764-15485786 CCTGCTCTTAAGATCAAGGAAGG + Intronic
1022010105 7:26301385-26301407 GCTCCTTTTTAGATTCAGGCTGG + Intronic
1022082759 7:27039313-27039335 TTTGCTCTTTTGGTCCAGGCTGG + Intergenic
1022220546 7:28309549-28309571 GCTGGTGTTGAGAGCCAGGCTGG + Intronic
1022711500 7:32855043-32855065 AATGCTGTTTACATCCAGGCCGG + Intergenic
1022913155 7:34919916-34919938 AATGCTGTTTACATCCAGGCCGG - Intergenic
1024318638 7:48044157-48044179 GCTGCACTTCTGATCCAGGGAGG - Intronic
1026086069 7:67264314-67264336 GGTGCTCTTTATATCAAGGAGGG + Intergenic
1026691088 7:72550495-72550517 GGTGCTCTTTATATCAAGGAGGG - Intergenic
1028307986 7:89290458-89290480 GCTGCTCTCTGGCTCCAGGAAGG - Intronic
1029538112 7:101167497-101167519 ACTGCTCTCTGTATCCAGGCTGG - Intergenic
1030041213 7:105452139-105452161 GCTGCTCTAAAGATCCATGTAGG + Intronic
1030448396 7:109676838-109676860 TCTACTCCTTAGATCCAGCCTGG + Intergenic
1031998035 7:128245754-128245776 GCTGCTCTTTAGATCCAGGCTGG - Intronic
1034044381 7:147912608-147912630 GCCACTCTTCAAATCCAGGCAGG + Intronic
1034277053 7:149828634-149828656 CCTGCCATTCAGATCCAGGCTGG - Intergenic
1034741001 7:153473199-153473221 GCTGCTCTTCAGACTCAGACTGG + Intergenic
1035219760 7:157399343-157399365 GCTGTTCTTTAGCACCAAGCAGG - Intronic
1037943194 8:22970211-22970233 GCTGCTCTTTACCTCCAAGATGG + Intronic
1039412147 8:37364006-37364028 GCTGATCTTTAGTTCCAGCCTGG - Intergenic
1041168863 8:55119930-55119952 GATGCTCTGTAAATGCAGGCTGG + Intronic
1049033065 8:140051286-140051308 GCTGCTCTGTCCATCCTGGCAGG - Intronic
1050752378 9:8955186-8955208 GCTGTTCTTTAGCTCCAGTGAGG + Intronic
1051432864 9:16998428-16998450 GCTGCTCTAAAGATGGAGGCAGG + Intergenic
1059673721 9:116516519-116516541 GCTGCTCTGTCCATCCAGGCAGG - Intronic
1061376016 9:130225238-130225260 GCTGCTTATTAGATTCTGGCTGG + Intronic
1062414639 9:136442100-136442122 GCTGCTCTGCAGAGCCAGCCTGG + Intronic
1187730460 X:22248086-22248108 GATGCTGTCTAGATCCAAGCAGG - Exonic
1190421559 X:50289883-50289905 GCTGCTCTTTAGATTCTGTATGG + Intronic
1193618793 X:83725327-83725349 GCTGCTCTGTTCATCCAGGTGGG - Intergenic
1195985264 X:110622297-110622319 GCTGCTCTGTCCATCCAAGCTGG + Intergenic
1199724042 X:150564859-150564881 GCTGCTTTTTAAATACAGACTGG + Intergenic
1199868257 X:151873635-151873657 TCAGGTCTTCAGATCCAGGCTGG + Intergenic