ID: 1031999328

View in Genome Browser
Species Human (GRCh38)
Location 7:128254552-128254574
Sequence CCAACGACCTGGAGAACCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031999321_1031999328 15 Left 1031999321 7:128254514-128254536 CCTCACCAGTATGCCTTCCAGAA 0: 1
1: 0
2: 0
3: 15
4: 126
Right 1031999328 7:128254552-128254574 CCAACGACCTGGAGAACCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 101
1031999323_1031999328 2 Left 1031999323 7:128254527-128254549 CCTTCCAGAAACGTGATCCAAAT 0: 1
1: 0
2: 2
3: 24
4: 174
Right 1031999328 7:128254552-128254574 CCAACGACCTGGAGAACCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 101
1031999320_1031999328 24 Left 1031999320 7:128254505-128254527 CCAACAGATCCTCACCAGTATGC 0: 1
1: 0
2: 1
3: 7
4: 127
Right 1031999328 7:128254552-128254574 CCAACGACCTGGAGAACCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 101
1031999322_1031999328 10 Left 1031999322 7:128254519-128254541 CCAGTATGCCTTCCAGAAACGTG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1031999328 7:128254552-128254574 CCAACGACCTGGAGAACCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 101
1031999324_1031999328 -2 Left 1031999324 7:128254531-128254553 CCAGAAACGTGATCCAAATATCC 0: 1
1: 0
2: 0
3: 13
4: 272
Right 1031999328 7:128254552-128254574 CCAACGACCTGGAGAACCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031999328 Original CRISPR CCAACGACCTGGAGAACCTC CGG Exonic
900102523 1:967921-967943 GCAACAACCTGCTGAACCTCGGG + Intronic
900577455 1:3390383-3390405 CAAACGACCTGTAGCACCCCTGG + Intronic
905344652 1:37302964-37302986 CCAAGCACCTGTAGAACCTGCGG - Intergenic
910426384 1:87123420-87123442 CCAGCGACCTGGAGAAGCCAAGG + Intronic
912492588 1:110070385-110070407 CCAAGTACCTGCAGGACCTCGGG - Exonic
912827284 1:112917232-112917254 CCACAGCGCTGGAGAACCTCTGG + Exonic
914832781 1:151182760-151182782 CCAACGAGTTGGAGAAACCCAGG - Intronic
922165289 1:223110555-223110577 CCAACATCCTGGAGATCCTCAGG + Exonic
1063300659 10:4846210-4846232 GCAAGGACCTGGAGCACCCCAGG - Intronic
1065875340 10:29993130-29993152 CCAAAGGCCAGGAGAGCCTCAGG + Intergenic
1070977901 10:80620089-80620111 ACAATGACCTGGAGAACGTGTGG - Intronic
1073109635 10:101053735-101053757 CAAACCACATGGAGAATCTCAGG - Intergenic
1074158060 10:110815460-110815482 CCAAGGACCTGGTGAACCAGTGG + Intronic
1075479512 10:122767985-122768007 CCAGCAACTTGGATAACCTCAGG + Intergenic
1076875076 10:133211764-133211786 GCACAGACCTGGAGAACCCCAGG + Exonic
1078580007 11:12532165-12532187 CTGATGACCTTGAGAACCTCAGG + Intergenic
1079834579 11:25317349-25317371 CCAAGGTCTTGGAGAACCCCAGG - Intergenic
1081600536 11:44489629-44489651 CCAAGGCCTTGGAGGACCTCTGG - Intergenic
1082747501 11:56980993-56981015 CCCACTTCCTGGAGAACCTGAGG - Intergenic
1087725372 11:101709460-101709482 CCAACGATCTGGACATCCTTTGG + Intronic
1089134382 11:116237622-116237644 CCAATAACTAGGAGAACCTCCGG - Intergenic
1090731241 11:129574831-129574853 GAAACGTCCTGGAGAGCCTCCGG - Intergenic
1092961123 12:13597778-13597800 CCAAGGACCTGGACAACTTCTGG + Intronic
1098740838 12:74171485-74171507 CCGACGAGCTGGAGAAGTTCTGG + Intergenic
1102423857 12:112825083-112825105 CCCCCCACCTGGAGGACCTCTGG - Intronic
1105303319 13:19153586-19153608 CCAACGACCTGGACAAGATGGGG - Intergenic
1106317554 13:28608151-28608173 CCGATGACCTGGAGGACCACAGG + Intergenic
1109624590 13:64958405-64958427 CCAACGATCTGGAGGACTCCAGG - Intergenic
1118397260 14:65348148-65348170 CCAACCAACTGAAGAACCACTGG - Intergenic
1118726580 14:68633195-68633217 CCAAGGACCTGGAGAGTCTGTGG - Intronic
1121991298 14:98560258-98560280 CCAAGAACCTGGACAACCACTGG + Intergenic
1125538129 15:40454515-40454537 CCAAAGACCCAGAGAACCACAGG - Intronic
1125584126 15:40808255-40808277 CCAGCGACCTGGAGAAGGGCAGG - Intronic
1126339780 15:47626485-47626507 CCAAAGACTTGGAGAAACTGAGG + Intronic
1130273129 15:82462758-82462780 TCATAGGCCTGGAGAACCTCAGG - Intergenic
1130460754 15:84157042-84157064 CCTAGGACATGCAGAACCTCTGG - Intergenic
1130465481 15:84190129-84190151 TCATAGGCCTGGAGAACCTCAGG - Intergenic
1130487211 15:84404691-84404713 TCATAGGCCTGGAGAACCTCAGG + Intergenic
1130498784 15:84483407-84483429 TCATAGGCCTGGAGAACCTCAGG + Intergenic
1130587770 15:85194724-85194746 TCATAGGCCTGGAGAACCTCAGG - Intergenic
1133020595 16:2965143-2965165 CCAGCCTCCTGGAGAACCTGGGG + Intronic
1136673686 16:31879967-31879989 CACACATCCTGGAGAACCTCAGG - Intronic
1137338252 16:47572484-47572506 TCAACCATCTGGAGAAGCTCTGG + Intronic
1140208210 16:72950517-72950539 CCAACAGCCTGGAGAAGCTGCGG - Exonic
1141573650 16:84950369-84950391 CCACCGAGCTGCACAACCTCTGG + Intergenic
1145005397 17:19334556-19334578 GCAACATCCTGGAGACCCTCGGG - Exonic
1145122927 17:20277011-20277033 CCAAAGACCTGGAGCAGATCTGG + Intronic
1145126783 17:20307505-20307527 CCAATGAGCTGGAGAAACCCAGG - Intronic
1146694288 17:34896999-34897021 CAAACAAACTTGAGAACCTCTGG + Intergenic
1152291601 17:79443009-79443031 CCACCTGCCTGGAGAACCCCTGG + Intronic
1152833137 17:82511289-82511311 CCAAGAACCTGGACAACCACAGG - Intergenic
1160185711 18:76674802-76674824 CCAGCGACCTTGAGAGCCTGTGG - Intergenic
1160833216 19:1112848-1112870 CCATCGACCACGTGAACCTCAGG - Exonic
1160859873 19:1233249-1233271 CCAGCCACCTGCAGAACCTCAGG + Intronic
1161093560 19:2375836-2375858 TCAACGACCTGGGGAAACTGAGG + Intergenic
1162112168 19:8405142-8405164 CCAGCGACCTGGAGCTCTTCTGG - Intronic
1164686072 19:30167618-30167640 CCACTGGCCTGGAGAACTTCAGG + Intergenic
1167605807 19:50480820-50480842 CCAGGGACCTGGAGACCCTGAGG - Intronic
925212440 2:2061483-2061505 GCAACAACCTTGAGAACCCCAGG + Intronic
936646037 2:114374229-114374251 CCAAGAACCTGGAGAACCAAAGG + Intergenic
943544895 2:189263235-189263257 CCACCAACCTTGAGAACCACAGG + Intergenic
944621819 2:201523260-201523282 CCAAGGACCAGGAACACCTCAGG + Intronic
947257604 2:228182704-228182726 CCAAAGTCTGGGAGAACCTCAGG - Intergenic
948180581 2:235976750-235976772 CCAGCTGCCTGGAGGACCTCAGG + Intronic
1178003578 21:28192187-28192209 ACAACTACCTGGGGAATCTCAGG + Intergenic
1178088394 21:29135935-29135957 GCACCTACCTGGAGAACCTAGGG + Intronic
1178605683 21:34034742-34034764 CCAAAGACCTGGACAACCTAGGG + Intergenic
1180613039 22:17109708-17109730 CCGAGGACCTGGAGAGCCTGAGG + Exonic
1183259856 22:36787695-36787717 CCCAAGACCTGGAGAAGCTGGGG + Intergenic
949700562 3:6752244-6752266 CCAAAGTTCTGAAGAACCTCTGG + Intergenic
960996302 3:123342703-123342725 CCTACGACCTTTAAAACCTCAGG + Intronic
961017515 3:123479302-123479324 GCCAGGACCTGGAGAACCTGAGG + Intergenic
965100273 3:164289240-164289262 CCAACAACTTGTAGAATCTCAGG - Intergenic
965686969 3:171314435-171314457 ACATCAACTTGGAGAACCTCTGG - Intronic
968470695 4:781182-781204 CCAACGCCCTGCAGACCCCCAGG + Intergenic
971390155 4:26178254-26178276 CGAACTAGCTGGAGAACCACTGG + Intronic
974794900 4:66736024-66736046 CCAAAGACCTGGATAGCCTGAGG + Intergenic
983119217 4:163859703-163859725 CCACTGTCCTGGAGATCCTCAGG + Intronic
985900794 5:2789023-2789045 CCAGCGACCTGGAGATCGTGAGG + Intergenic
991662183 5:68961645-68961667 CCCTCTAGCTGGAGAACCTCTGG + Intergenic
998746690 5:145268218-145268240 CCAATGTCCTGGAGAATTTCTGG + Intergenic
998906134 5:146907355-146907377 CCAATGTCCTGAAGAAGCTCTGG - Intronic
1000370233 5:160528153-160528175 TCAAAGAACTGGTGAACCTCAGG + Intergenic
1003325301 6:5085997-5086019 CCGAGGACCTGGAGCAGCTCGGG + Exonic
1006467334 6:34203427-34203449 CCAAAGACCTGAAGAACAGCAGG + Intergenic
1007308134 6:40923215-40923237 CCACAGACCTAGAGAACCTGTGG + Intergenic
1007693884 6:43719564-43719586 CCAATGGCCTGGAGGACCCCTGG + Intergenic
1015509187 6:134020847-134020869 CCAACGAGTTGGAGAATCTCAGG - Intronic
1016769205 6:147829694-147829716 CCATCCACCTGGAGAACACCTGG - Intergenic
1019500675 7:1363028-1363050 CAACCGAGATGGAGAACCTCAGG - Intergenic
1019914207 7:4122084-4122106 CCTACCACCTGGGGAATCTCAGG + Intronic
1020007511 7:4790374-4790396 CCAAGGGCCTGGAGAAACCCGGG - Intronic
1022286138 7:28957312-28957334 CCAACAACCTGCAGCACCTCGGG - Exonic
1031999328 7:128254552-128254574 CCAACGACCTGGAGAACCTCCGG + Exonic
1034525009 7:151653447-151653469 ACGACAACCTGGATAACCTCAGG + Intronic
1035930164 8:3771566-3771588 CTAGAGACCTGGAGAGCCTCAGG + Intronic
1042225753 8:66513237-66513259 CCACTGACCTAGAGAAACTCAGG - Intronic
1055427364 9:76210254-76210276 TCAACGTCGTGGAGAAACTCTGG + Intronic
1056714260 9:89015006-89015028 CCAACAATCAGGAGACCCTCTGG - Intronic
1059950257 9:119454861-119454883 CCAACCATTTGGACAACCTCAGG + Intergenic
1060829107 9:126702715-126702737 CTAACGACTTGGAGGACCTCCGG + Intergenic
1195582608 X:106524831-106524853 CCAACAAACTGGATAACCTAGGG - Intergenic
1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG + Intergenic
1200066699 X:153507399-153507421 CGACCCACCTGGAGACCCTCGGG - Intronic
1200073769 X:153541374-153541396 CCAATGACCTGGAGAAGCGCAGG + Exonic
1200830102 Y:7680804-7680826 CCAACCAGCTGAAGAAGCTCAGG - Intergenic
1200887271 Y:8281982-8282004 CCAACCAGCTGCAGAAGCTCAGG - Intergenic
1200988578 Y:9327690-9327712 CCAACCAGCTGAAGAAGCTCAGG - Intergenic
1201060257 Y:10038148-10038170 CCAACCAGCTGAAGAAGCTCAGG - Intergenic
1202195545 Y:22296005-22296027 CCAACCAGCTGAAGAATCTCAGG - Intergenic