ID: 1032000070

View in Genome Browser
Species Human (GRCh38)
Location 7:128259517-128259539
Sequence AAGCCAACTCCCCCCACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032000066_1032000070 3 Left 1032000066 7:128259491-128259513 CCTGCTGGGCCTCAGGTGTCCCA No data
Right 1032000070 7:128259517-128259539 AAGCCAACTCCCCCCACCCAAGG No data
1032000064_1032000070 9 Left 1032000064 7:128259485-128259507 CCCAGTCCTGCTGGGCCTCAGGT No data
Right 1032000070 7:128259517-128259539 AAGCCAACTCCCCCCACCCAAGG No data
1032000062_1032000070 10 Left 1032000062 7:128259484-128259506 CCCCAGTCCTGCTGGGCCTCAGG No data
Right 1032000070 7:128259517-128259539 AAGCCAACTCCCCCCACCCAAGG No data
1032000067_1032000070 -6 Left 1032000067 7:128259500-128259522 CCTCAGGTGTCCCACAGAAGCCA No data
Right 1032000070 7:128259517-128259539 AAGCCAACTCCCCCCACCCAAGG No data
1032000065_1032000070 8 Left 1032000065 7:128259486-128259508 CCAGTCCTGCTGGGCCTCAGGTG No data
Right 1032000070 7:128259517-128259539 AAGCCAACTCCCCCCACCCAAGG No data
1032000059_1032000070 22 Left 1032000059 7:128259472-128259494 CCTCAAGCTCTGCCCCAGTCCTG No data
Right 1032000070 7:128259517-128259539 AAGCCAACTCCCCCCACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032000070 Original CRISPR AAGCCAACTCCCCCCACCCA AGG Intergenic
No off target data available for this crispr