ID: 1032001919

View in Genome Browser
Species Human (GRCh38)
Location 7:128271257-128271279
Sequence CTGGTGGCTGGCATCCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032001919_1032001927 7 Left 1032001919 7:128271257-128271279 CCCACTGGGATGCCAGCCACCAG No data
Right 1032001927 7:128271287-128271309 ATCCTGATGCTGTGTGGCCTGGG No data
1032001919_1032001931 29 Left 1032001919 7:128271257-128271279 CCCACTGGGATGCCAGCCACCAG No data
Right 1032001931 7:128271309-128271331 GCACACGTTTTCCCCATTCTGGG No data
1032001919_1032001930 28 Left 1032001919 7:128271257-128271279 CCCACTGGGATGCCAGCCACCAG No data
Right 1032001930 7:128271308-128271330 GGCACACGTTTTCCCCATTCTGG No data
1032001919_1032001926 6 Left 1032001919 7:128271257-128271279 CCCACTGGGATGCCAGCCACCAG No data
Right 1032001926 7:128271286-128271308 AATCCTGATGCTGTGTGGCCTGG No data
1032001919_1032001925 1 Left 1032001919 7:128271257-128271279 CCCACTGGGATGCCAGCCACCAG No data
Right 1032001925 7:128271281-128271303 AGTCTAATCCTGATGCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032001919 Original CRISPR CTGGTGGCTGGCATCCCAGT GGG (reversed) Intergenic
No off target data available for this crispr