ID: 1032006476

View in Genome Browser
Species Human (GRCh38)
Location 7:128305867-128305889
Sequence TGAGAGGAATAAAACTGGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 279}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032006476 Original CRISPR TGAGAGGAATAAAACTGGAC AGG Exonic
901912565 1:12472326-12472348 TGAGAGGAGCAAAACTGAATGGG + Intronic
902693479 1:18125094-18125116 GGAGAGACATAAAACTGGACAGG + Intronic
904764432 1:32832831-32832853 GGAGAGGATTCAAACTGAACTGG - Intronic
905419848 1:37833927-37833949 TGAGAGGAAGAAAAGTAGGCAGG + Intronic
905914444 1:41675136-41675158 TGAGAGGATTTAAGCAGGACAGG - Intronic
907763281 1:57383061-57383083 TGAGGGGAATAAAAGTGGCAGGG + Intronic
908959723 1:69681784-69681806 GGACAGGAATCAGACTGGACTGG - Intronic
909676121 1:78241004-78241026 ACAGAGGAACAAAACTGGAGGGG - Intergenic
910127146 1:83855263-83855285 GGAGATGAAGAAAACTGGAGAGG - Intergenic
910230979 1:84986242-84986264 GTAGAAGAATAAAACTGGGCCGG + Intronic
910594066 1:88959763-88959785 TGAGGGGAATAAAAAAGGAGTGG - Intronic
912253600 1:108036340-108036362 TGAGAGTCTCAAAACTGGACTGG + Intergenic
914334305 1:146700926-146700948 TGAGAGGTACAAAACTGGTGAGG - Intergenic
914791051 1:150877403-150877425 AAAGAGGAAAAAAACTGGAAAGG - Intergenic
914935543 1:151976291-151976313 TGAGAGTACTAAAACAGGAATGG - Intergenic
916101532 1:161397325-161397347 AGAACGGAATAGAACTGGACAGG - Intergenic
917616312 1:176748481-176748503 TAAGGGGAAAAAATCTGGACAGG - Intronic
921762550 1:218932821-218932843 TGAGCAGAATAAAAATGTACTGG + Intergenic
922199257 1:223387978-223388000 AGAGAGAAAGAAAACTGGCCAGG + Intergenic
923467856 1:234265222-234265244 TGAGAGGAATAGAACATGAAGGG - Intronic
1063908225 10:10802550-10802572 TGAGAGAAAAAAAAGTTGACAGG + Intergenic
1065486686 10:26242536-26242558 GGAGAGGAAGAAAACTTGAGAGG - Intronic
1065685309 10:28278745-28278767 AGAGGGAAATAAAACTGGAAAGG + Intronic
1067187176 10:44040506-44040528 TGTGGGGCATAAAACTGGAGAGG + Intergenic
1067535534 10:47107176-47107198 TGGGAGGAATGAATCAGGACAGG - Intergenic
1067552283 10:47244443-47244465 GCCGAGGAAGAAAACTGGACTGG - Intergenic
1067629053 10:47946426-47946448 TGTTGGGAATAAGACTGGACCGG - Intergenic
1069665551 10:70154400-70154422 TGAGAGGAATAAAGTAGGAAGGG + Intronic
1070435587 10:76389313-76389335 TGACAGGAATAAAATTAGAAGGG + Intronic
1070723204 10:78770882-78770904 TGAGATGAAGAAAACTGGGTCGG + Intergenic
1070769972 10:79076537-79076559 TGAGAGAAGTAAAACAGGGCCGG + Intronic
1072635847 10:97177325-97177347 GGACAGGAATAAAGCTGGAAAGG - Intronic
1072910348 10:99495445-99495467 TAAGAAGAACAAAGCTGGACTGG + Intergenic
1072924958 10:99609063-99609085 TTAGAGGAGCAAGACTGGACAGG - Intergenic
1073067736 10:100773671-100773693 TGAGAGGAATATTATTGGCCTGG + Intronic
1074136772 10:110634359-110634381 TTAGAGGAATACAAATTGACAGG + Intergenic
1074432780 10:113408069-113408091 AGAGAGGGATAAAGCTGGTCAGG - Intergenic
1074841205 10:117353330-117353352 TGAGAGCCATCAAACTGCACTGG - Intronic
1077146227 11:1047165-1047187 TGAGATGAAACACACTGGACAGG - Intergenic
1078325191 11:10374965-10374987 TTAGAGGTATAAAACTGGAGTGG + Intronic
1079088297 11:17462865-17462887 TGAGAGGAAAAAACCTGAATAGG + Intronic
1080396346 11:31893727-31893749 TGATAAGAACAAAATTGGACAGG - Intronic
1083232437 11:61331897-61331919 TCAGACTAAGAAAACTGGACTGG + Intronic
1086663166 11:89447066-89447088 TAAGAGGAAAAAAAATGGACAGG + Intronic
1087661520 11:100994280-100994302 TAAGACTAATAAAAATGGACAGG - Intergenic
1087981951 11:104626064-104626086 TGAGAGGGAAAAAAATGGAGTGG - Intergenic
1088507587 11:110541508-110541530 TCAGAAAAATAAAACTGGACTGG - Intergenic
1088939107 11:114435784-114435806 TGGGAAGAACAAAACTGGTCTGG + Intronic
1089823567 11:121250739-121250761 TGACAGGCATAAAACTGGCAGGG + Intergenic
1089871042 11:121672850-121672872 GGAGAGGAAAACAACTGCACAGG + Intergenic
1091764313 12:3108422-3108444 TCAAAGGAATAAAACTGGAATGG - Intronic
1091892536 12:4071407-4071429 TCACAGGAGTAAAAATGGACAGG - Intergenic
1092555985 12:9562073-9562095 TGAGAGAAATAAAAATGCAAGGG + Intergenic
1093505189 12:19857077-19857099 AAGAAGGAATAAAACTGGACAGG + Intergenic
1094516111 12:31128575-31128597 TGAGAGAAATAAAAATGCAAGGG - Intergenic
1096852753 12:54452438-54452460 TTAAATGATTAAAACTGGACTGG - Intergenic
1098453912 12:70650897-70650919 TGAGAGGTATATGACTGCACTGG - Intronic
1098580086 12:72089257-72089279 TGAGAAGAAAAAAACTGGAGAGG - Intronic
1100144304 12:91658645-91658667 TGTAAGGAATAAAATTTGACTGG - Intergenic
1100589623 12:96014168-96014190 GGAGAAAAATAAGACTGGACAGG + Intronic
1100739552 12:97576308-97576330 TGAGACCAATAAAACAAGACAGG - Intergenic
1101522378 12:105495845-105495867 TAAGAAGAATAAAGCTGGAGAGG + Intergenic
1102352681 12:112205887-112205909 AGAGAGAAATAAACCTGGCCAGG - Intronic
1103055701 12:117818429-117818451 TGAGAAGAATAAAAATGGCAAGG + Intronic
1103489215 12:121303973-121303995 TTCGAGGAAAAAAACTGGCCGGG + Intergenic
1105027886 12:132861638-132861660 TGAGAGGAATCAAACAAGATAGG + Intronic
1105768148 13:23580642-23580664 TGAAAGGTATAGAACTGGAGGGG + Intronic
1107007230 13:35626952-35626974 TGAAAGGAATAAATCAGGAAAGG + Intronic
1107196654 13:37660507-37660529 TGAAAGGAATGAAACAGGAGTGG + Intronic
1107494800 13:40915824-40915846 TGAGAAGATTAAGACTGGAGAGG - Intergenic
1109680503 13:65746193-65746215 TGACAGGTCTAAGACTGGACTGG + Intergenic
1109832906 13:67815546-67815568 TGACAGAAAGAAAACTGCACGGG - Intergenic
1111685053 13:91491516-91491538 TGAAAGGAATAAAAAAGGACAGG - Intronic
1112253455 13:97805760-97805782 TGAGAAGAATAAAAATATACAGG + Intergenic
1114779457 14:25521785-25521807 ACAAAGGAATAAAACTGGACCGG - Intergenic
1118384645 14:65245513-65245535 TGACAGGAAAGAAGCTGGACAGG + Intergenic
1119136196 14:72222917-72222939 TGAGATAAATAAAACTGCTCAGG - Intronic
1120291023 14:82570586-82570608 TCGGAGGAATAAAACAGAACAGG - Intergenic
1121847511 14:97186309-97186331 AGAGAGGAATAAAAGTGGACTGG + Intergenic
1122839280 14:104447227-104447249 TGGGAGGAATAGAACTGTGCAGG + Intergenic
1124470101 15:29976759-29976781 TGCCAGGAATAAAAGTGGAGAGG - Intergenic
1125871531 15:43106331-43106353 TGAAAGGAAGAAAACTTGTCGGG + Intronic
1126410334 15:48367204-48367226 TGGGAGGAAAAATACTGGAAGGG - Intergenic
1126590261 15:50332176-50332198 GGAGAGAAAAGAAACTGGACAGG - Intronic
1127095756 15:55510930-55510952 AGAACGGAATAAAACAGGACAGG + Intergenic
1127371251 15:58343915-58343937 TGAGAACAAAAAAACTGAACAGG + Intronic
1129598400 15:76982702-76982724 GGAGAGGAAAAAAAGGGGACTGG + Intergenic
1130019297 15:80213989-80214011 TGAGAATAATAAAACTGGTAAGG + Intergenic
1131056922 15:89380468-89380490 TGAGAGGATGGGAACTGGACTGG - Intergenic
1131812837 15:96190505-96190527 TGAGGGGAACAAAAGAGGACTGG - Intergenic
1132042430 15:98536551-98536573 CGAGAGGAATGAATCTGGATAGG + Intergenic
1132182864 15:99773316-99773338 TGAGAGGAAAAAAAAAGGACGGG - Intergenic
1133147532 16:3800974-3800996 AGTGAGGAATAAAGATGGACTGG - Intronic
1134172287 16:11977617-11977639 TGAGAGGAAGAAGTTTGGACTGG - Intronic
1136318750 16:29468903-29468925 TGAGAGCCATGAAACTGGGCTGG + Intergenic
1136433322 16:30208247-30208269 TGAGAGCCATGAAACTGGGCTGG + Intronic
1138917007 16:61476986-61477008 TGAGAAGAAGAAAAGTGAACTGG + Intergenic
1139900665 16:70325978-70326000 GGGGAGGAATAAAAATGGACTGG - Intronic
1141201924 16:81904821-81904843 TGAGAGGAATAAAGCAGGCTTGG + Intronic
1141881786 16:86865114-86865136 GGAGAGGAATGAGACTGGGCGGG + Intergenic
1142554924 17:768696-768718 TTAGAGGAAGAAATCTGGAGAGG + Intronic
1142814454 17:2414399-2414421 TGCAAGGAATGGAACTGGACGGG + Intronic
1143609917 17:8012292-8012314 AGAGAGAAATAAAGCTGGACTGG + Exonic
1148945778 17:51260601-51260623 GGAGACGAATGAAACTGGACCGG + Exonic
1149289469 17:55202572-55202594 TAAGAGGAATAAAACTGGCCAGG + Intergenic
1150010664 17:61499797-61499819 TTTGAAGAATAAAACTGGAGGGG + Intergenic
1150057467 17:62031640-62031662 TGAAAGGAAAAAAATGGGACAGG + Intronic
1150231216 17:63551749-63551771 TAAGAAGAGTAAAACTGGCCGGG + Intronic
1151149560 17:72072662-72072684 GGAGAGGAAGAAAGCTGGAGAGG + Intergenic
1154331645 18:13434427-13434449 TCAGATGTATAATACTGGACTGG - Intronic
1155865505 18:30960024-30960046 TGAGAAGAATAGAAAGGGACAGG - Intergenic
1157156432 18:45271278-45271300 AGAAAGAACTAAAACTGGACTGG - Intronic
1159803938 18:72932041-72932063 TTAGAAAAATAAAAATGGACTGG + Intergenic
1161126187 19:2559093-2559115 TGAAAGGAATATAACTGGCTGGG - Intronic
1162864947 19:13538572-13538594 TGAGGGGAAGAAAACTGGGGCGG + Intronic
1163209388 19:15829392-15829414 AGAGAAGAAAAAGACTGGACAGG - Intergenic
1163924132 19:20322411-20322433 TTAAAGGACTAAAAATGGACTGG - Intergenic
1163961492 19:20699574-20699596 TGTGATGAATAAAACTGGAAAGG + Intronic
1168454514 19:56495957-56495979 TGCGAGGACAAAAACTGCACTGG + Intergenic
925912965 2:8585032-8585054 TGGGAGGGATAAAAATGGTCTGG + Intergenic
931332294 2:61300268-61300290 TGGGAGGAATGAAATTGGAAAGG - Intronic
932096685 2:68856345-68856367 TGAAATGAAGAAAACTGGTCAGG + Intergenic
935793638 2:106617985-106618007 TGAGGGGAATAAATGTGGAGAGG + Intergenic
937778880 2:125813511-125813533 TCAGAGGATTATCACTGGACAGG + Intergenic
938642614 2:133296790-133296812 CAATAGGAAGAAAACTGGACTGG - Intronic
939371335 2:141304795-141304817 TCAAAAGAATGAAACTGGACTGG - Intronic
939980756 2:148777812-148777834 TCTGAGGAATAAAAGTAGACTGG + Intronic
940390342 2:153125251-153125273 TGGGAGGAAGAATACTGGCCTGG - Intergenic
940462562 2:153985412-153985434 CAAGAGGAATACAACTGAACAGG - Intronic
940663712 2:156579743-156579765 TGATTTGAATAAAAATGGACAGG + Exonic
941182165 2:162272647-162272669 TGAGAGCAAAAAGCCTGGACAGG - Intronic
941704844 2:168647085-168647107 TGATAGGAATAATATTGAACCGG + Intronic
942170635 2:173286346-173286368 TGAGAGGACTGAAACTCGATTGG - Intergenic
942400442 2:175596033-175596055 TGAGAGGAAGAGCACTGGACTGG - Intergenic
944739976 2:202602465-202602487 CTAGAGGAATATAACTGGAGTGG - Intergenic
944881585 2:204018296-204018318 TGAGAGGAAATAACCTTGACGGG + Intergenic
945021254 2:205573818-205573840 TGAGAAGTAGAAAACTGCACAGG + Intronic
947951458 2:234151283-234151305 TGAGAGGCATAAAAATGAATGGG - Intergenic
948995672 2:241576995-241577017 TGAAATGAATGAAAATGGACTGG - Intergenic
1170354103 20:15473439-15473461 AGAGAAGAATAAAATTAGACTGG + Intronic
1170657676 20:18305041-18305063 TTAAAAGAATAAAACTGGGCAGG + Intronic
1173133823 20:40421562-40421584 TGAGAAGAATATAACTGGACTGG + Intergenic
1173512635 20:43642251-43642273 TAATCAGAATAAAACTGGACTGG - Intronic
1174649555 20:52113029-52113051 AAAGAGGTATAAAACTAGACAGG + Intronic
1174985510 20:55447541-55447563 GAAGAGTAAGAAAACTGGACTGG + Intergenic
1178313690 21:31551940-31551962 GGATGGGAATAAAACAGGACCGG + Intronic
1181452272 22:23031470-23031492 AGACAGGAATAAAGGTGGACAGG - Intergenic
1183051945 22:35270008-35270030 TGAGAGAAATAAAATTGAAGAGG + Intronic
1183996459 22:41636907-41636929 AGAAAGCAATAAAACTGCACTGG - Intronic
1184061346 22:42083980-42084002 TGAGAGGAAGAAATGTAGACAGG + Exonic
949554293 3:5139764-5139786 TTAGAGAAATGAAACTGAACGGG + Intronic
952985147 3:38772387-38772409 TTAGAGAAATAAAACTGTATTGG + Intronic
956349813 3:68322339-68322361 TGAGAGGAATAAAACGTCAAGGG - Intronic
957923833 3:86781864-86781886 TGATAGCAATAATACTAGACTGG + Intergenic
958112280 3:89163869-89163891 TGAGGTCAATAAAACTGGTCTGG + Intronic
959506046 3:107157116-107157138 GCAAAGGAACAAAACTGGACGGG + Intergenic
959755945 3:109898996-109899018 TAAGAGGAAGAAAAGTAGACTGG - Intergenic
959990110 3:112621904-112621926 TGAGAGATACAAGACTGGACAGG - Intronic
960488528 3:118281982-118282004 ATAGAGGAAAAAAACTGGAAAGG + Intergenic
965123354 3:164592492-164592514 TTAGAGAAATCAAACTGGAGGGG + Intergenic
968255779 3:197270052-197270074 TGAGAGGTAAGAAAGTGGACAGG - Intronic
971399440 4:26262508-26262530 TGGTAAGAAGAAAACTGGACAGG - Intronic
971550363 4:27947699-27947721 TGCTAAGAATAAAACTGGCCTGG + Intergenic
971731684 4:30391589-30391611 TGAGAGGAATAGAAGAGGAAAGG + Intergenic
973089872 4:46123016-46123038 TAACAGAAACAAAACTGGACTGG - Intronic
973147133 4:46841196-46841218 AGAGAGGAGTAAAAATGGAGAGG + Intronic
975708302 4:77133522-77133544 TGAGAGGAAAGAAACAGGTCTGG + Intergenic
976338736 4:83921208-83921230 AGAGAGAAATGAAACTGGAAAGG + Intergenic
977065198 4:92305155-92305177 TGAGATGAAAAGAACTGGGCTGG + Intronic
979830140 4:125289557-125289579 GTAGAGGAATGAAACTGAACTGG - Intergenic
980746357 4:137022031-137022053 AGTGAGGAATAAAACAGGAAGGG - Intergenic
981173282 4:141649847-141649869 TGAGAAGAATAAAAATAGATTGG + Intronic
982633114 4:157857515-157857537 TGAGAGGAATAAAAGTGAAAAGG - Intergenic
983155985 4:164349334-164349356 TGAGAGGAATAAAAATGCAGAGG - Intronic
983361813 4:166735330-166735352 TGAGATCAATATTACTGGACTGG - Intronic
983500363 4:168492896-168492918 AGAGAGGAATAAAAGTGAAAAGG + Intronic
983586858 4:169364667-169364689 TGAGAGAAAAAAAACAGGATTGG - Intergenic
983655031 4:170074104-170074126 TAAGGGAAATAAAACTGTACTGG + Intronic
986494038 5:8323631-8323653 CCAGAGGAAAAAAACTGGCCAGG + Intergenic
986991360 5:13556830-13556852 TGAGAGGCATTCGACTGGACTGG + Intergenic
987845042 5:23272928-23272950 TGAGAGTAATAAAACTTGATGGG - Intergenic
988602682 5:32654430-32654452 TGAGAGGAAATAAACTAAACAGG - Intergenic
989408255 5:41086641-41086663 TAAGTGGAAGAATACTGGACAGG - Intergenic
990977519 5:61572705-61572727 GGAGAGAAATAAAACTAGAGAGG + Intergenic
992554966 5:77893982-77894004 TCAAAGGAATAAAAATGGGCTGG + Intergenic
994987187 5:106951582-106951604 TGAGAGGAATAACAATAGAAAGG - Intergenic
995518250 5:112975484-112975506 TGAGAGGAATAAGACTACTCAGG + Intergenic
999004149 5:147957521-147957543 TAAGAGGGATAGAACTGGATGGG + Intergenic
999908813 5:156173474-156173496 TGAAAGGAATAAAATTGAAAAGG + Intronic
1001124132 5:169004227-169004249 TCAGAGAAATAAAAGTGGATGGG + Intronic
1002034315 5:176454888-176454910 TGTCAGGAATACAACTTGACTGG - Intronic
1003436579 6:6094564-6094586 TAAGAGCAATAAAACTGGGTGGG - Intergenic
1003655263 6:8001368-8001390 TGTGAGGAAAAAAACAGGGCTGG + Intronic
1004091355 6:12505474-12505496 TGAGACAAATAAGACTGGAAAGG + Intergenic
1006153948 6:32004150-32004172 TGAGAGGGAGAAAACAGGATTGG - Intergenic
1006160255 6:32036887-32036909 TGAGAGGGAGAAAACAGGATTGG - Intergenic
1006743729 6:36326761-36326783 GGAGAGGAGAAAAACTGGTCAGG + Intronic
1008354994 6:50542186-50542208 TGAGAGAAAATAAACAGGACTGG - Intergenic
1008598777 6:53068424-53068446 TCAGTGGAATAAAGCTAGACTGG - Intronic
1009795281 6:68458244-68458266 TGAGAAGAATCAAACTCCACGGG - Intergenic
1009808343 6:68630678-68630700 GGAGAGGAATAAAAATGGAAAGG + Intergenic
1010619769 6:78060370-78060392 TGCGAGGAAGAAAGCTGCACAGG + Intergenic
1010790741 6:80062277-80062299 GGAGAGGGATGAAGCTGGACAGG - Intergenic
1010813252 6:80324404-80324426 GGAGAGGAAGAAATCAGGACAGG + Intronic
1011055743 6:83201651-83201673 TGAGAGAAATAACACTGGTGAGG - Intergenic
1011187803 6:84698289-84698311 TGAGAAGAATAAAACAGGAGAGG + Intronic
1012521514 6:100126754-100126776 TGGGTGGAATAAAATTGGACAGG - Intergenic
1012694270 6:102357280-102357302 TGAGAAAAATAAAACTTGGCAGG + Intergenic
1013051434 6:106539300-106539322 TGAGAGGAAAAGAACAGGAGAGG - Intronic
1013141349 6:107338802-107338824 TGAGAGAAATAAATCTGGAGGGG + Intronic
1014374009 6:120649647-120649669 TGATAGGAATAACACTGAATCGG - Intergenic
1015396895 6:132744916-132744938 TGAGAAAAAAAAAACTGAACTGG + Intronic
1016427998 6:143954755-143954777 TGAAAGGCATAAAATTGGAATGG + Intronic
1017406906 6:154129238-154129260 TGGGAGGAACAGAACAGGACAGG + Intronic
1018276095 6:162133180-162133202 TGATAGGAATAGGACTGGGCAGG + Intronic
1018344802 6:162889083-162889105 TGAGAGGGAGAAAACTGGGTTGG + Intronic
1020802577 7:12749766-12749788 GGAGAAGAAGAAAACAGGACTGG + Intergenic
1021494197 7:21255822-21255844 TGACAGGAATGATACTGCACTGG + Intergenic
1023185017 7:37524188-37524210 TGAGAAGAATAAATGTGGCCGGG + Intergenic
1024021218 7:45372779-45372801 TGAGAGGAAAAAAACTGATAAGG + Intergenic
1024551632 7:50566962-50566984 TGAGAGGAAGAAGACTGGGGTGG + Intergenic
1026508645 7:71008905-71008927 TGACAAGATTAAAGCTGGACAGG + Intergenic
1027146395 7:75698113-75698135 TGATAGTTATAAAACTGGGCTGG - Intronic
1027439380 7:78202384-78202406 TGAAAAGAATTAAACTGGGCCGG + Intronic
1027498367 7:78917247-78917269 TAAGAGGAGTAAATCTGGAGAGG + Intronic
1027545397 7:79521729-79521751 TGAGGGGATTAAAACTAGATAGG + Intergenic
1029566175 7:101339653-101339675 TGAAAGAAAGAAAACTGGCCTGG - Intergenic
1031845410 7:126799814-126799836 TTAGAGGGAGCAAACTGGACAGG - Intronic
1031852632 7:126883949-126883971 TGAAAGAAATAAAATTAGACAGG + Intronic
1032006476 7:128305867-128305889 TGAGAGGAATAAAACTGGACAGG + Exonic
1037037376 8:14183816-14183838 CCAGAGGAATAAAACTAGAATGG + Intronic
1038421036 8:27434184-27434206 TGAGAGGAATAAGAATAAACTGG + Intronic
1039015810 8:33147453-33147475 TGAGAGGAATAGAATAGGATAGG - Intergenic
1039247673 8:35627630-35627652 TAAAAAGAATAAAACTTGACTGG + Intronic
1039285826 8:36039880-36039902 TGAGTGGAATACAAAAGGACAGG - Intergenic
1039347324 8:36721806-36721828 TGAGAGGAAGAAAGCAGGAAGGG - Intergenic
1041123479 8:54610681-54610703 TGAGAGCAATAAAACTGTCAAGG - Intergenic
1041808313 8:61879698-61879720 TGATAGAAATAACACAGGACAGG + Intergenic
1042157073 8:65855871-65855893 TCAGAGGAATAAAGTTGGGCAGG - Intergenic
1045808077 8:106189158-106189180 TTAGAGGAATAAAACAAAACTGG + Intergenic
1046669514 8:117042553-117042575 TGTAAGGAATAAAACAGCACCGG - Intronic
1046695173 8:117331783-117331805 TGCCAGGAATCAAAATGGACAGG - Intergenic
1046864711 8:119134560-119134582 TGAATGGAATAAAACTGAATAGG + Intergenic
1046914738 8:119667880-119667902 TGAGAGAAATGAGACTGGAGTGG - Intronic
1048556341 8:135481137-135481159 TGGCAGAAATAAGACTGGACAGG - Intronic
1050851978 9:10299905-10299927 TGAGAGCAATGACACTGGGCTGG - Intronic
1051441298 9:17086046-17086068 TGAAAGTAATCTAACTGGACTGG - Intergenic
1053562073 9:39206887-39206909 TGAAAGCAATAAAAATGTACTGG + Intronic
1053827883 9:42044890-42044912 TGAAAGCAATAAAAATGTACTGG + Intronic
1054135045 9:61412071-61412093 TGAAAGCAATAAAAATGTACTGG - Intergenic
1054602677 9:67142556-67142578 TGAAAGCAATAAAAATGTACTGG - Intergenic
1056289271 9:85126368-85126390 GGAGAGGAATATGACTGAACAGG + Intergenic
1056447122 9:86676956-86676978 TTATAGGAATAAAACTGGCAAGG - Intergenic
1058782456 9:108352082-108352104 AGAGAGGCAGAAAACTGGTCAGG - Intergenic
1059338895 9:113586294-113586316 TGAGGGGAATAGAACTGGGAAGG - Intronic
1059672823 9:116507651-116507673 AGAGAGGAGTGAATCTGGACTGG - Intronic
1060398449 9:123332917-123332939 TGATGGGAAGAACACTGGACTGG - Intergenic
1062154888 9:135041960-135041982 TGAGAGGAAAAAGAGTGGAAGGG - Intergenic
1203692971 Un_GL000214v1:64165-64187 TCAGAGGAATAGAAAGGGACAGG - Intergenic
1203693025 Un_GL000214v1:64484-64506 TCAGAGGAATAGAAAGGGACAGG - Intergenic
1203693036 Un_GL000214v1:64548-64570 TCAGAGGAATAGAAAGGGACAGG - Intergenic
1203693059 Un_GL000214v1:64676-64698 TCAGAGGAATAGAAAGGGACAGG - Intergenic
1203693090 Un_GL000214v1:64868-64890 TCAGAGGAATAGAAAGGGACAGG - Intergenic
1203693111 Un_GL000214v1:64996-65018 TCAGAGGAATAGAAAGGGACAGG - Intergenic
1203693122 Un_GL000214v1:65060-65082 TCAGAGGAATAGAAAGGGACAGG - Intergenic
1203693153 Un_GL000214v1:65252-65274 TCAGAGGAATAGAAAGGGACAGG - Intergenic
1203693194 Un_GL000214v1:65508-65530 TCAGAGGAATAGAAAAGGACAGG - Intergenic
1203693226 Un_GL000214v1:65700-65722 TCAGAGGAATAGAAAGGGACAGG - Intergenic
1203557162 Un_KI270744v1:11058-11080 TCAGAGGAATAGAAAGGGACAGG - Intergenic
1203557184 Un_KI270744v1:11186-11208 TCAGAGGAATAGAAAGGGACAGG - Intergenic
1203557206 Un_KI270744v1:11314-11336 TCAGAGGAATAGAAAGGGACAGG - Intergenic
1203557303 Un_KI270744v1:11890-11912 TCAGAGGAATAGAAAGGGACGGG - Intergenic
1203557346 Un_KI270744v1:12146-12168 TCAGAGGAATAGAAAGGGACAGG - Intergenic
1203557434 Un_KI270744v1:12658-12680 TCAGAGGAATAGAAAGGGACGGG - Intergenic
1203557478 Un_KI270744v1:12914-12936 TCAGAGGAATAGAAAGGGACAGG - Intergenic
1203557510 Un_KI270744v1:13106-13128 TCAGAGGAATAGAAAGGGACGGG - Intergenic
1203557521 Un_KI270744v1:13170-13192 TCAGAGGAATAGAAAGGGACAGG - Intergenic
1203557543 Un_KI270744v1:13298-13320 TCAGAGGAATAGAAAGGGACAGG - Intergenic
1203557564 Un_KI270744v1:13426-13448 TCAGAGGAATAGAAAGGGACAGG - Intergenic
1203557653 Un_KI270744v1:13938-13960 TCAGAGGAATAGAAAGGGACGGG - Intergenic
1203643047 Un_KI270751v1:38363-38385 TCAGAGGAATAGAAAGGGACAGG + Intergenic
1203643079 Un_KI270751v1:38555-38577 TCAGAGGAATAGAAAAGGACAGG + Intergenic
1203643131 Un_KI270751v1:38875-38897 TCAGAGGAATAGAAAGGGACAGG + Intergenic
1203643152 Un_KI270751v1:39003-39025 TCAGAGGAATAGAAAGGGACAGG + Intergenic
1203643173 Un_KI270751v1:39131-39153 TCAGAGGAATAGAAAGGGACAGG + Intergenic
1203643184 Un_KI270751v1:39195-39217 TCAGAGGAATAGAAAGGGACAGG + Intergenic
1203643205 Un_KI270751v1:39323-39345 TCAGAGGAATAGAAAGGGACAGG + Intergenic
1203643236 Un_KI270751v1:39515-39537 TCAGAGGAATAGAAAGGGACAGG + Intergenic
1203643259 Un_KI270751v1:39643-39665 TCAGAGGAATAGAAAGGGACAGG + Intergenic
1203643270 Un_KI270751v1:39707-39729 TCAGAGGAATAGAAAGGGACAGG + Intergenic
1203643324 Un_KI270751v1:40026-40048 TCAGAGGAATAGAAAGGGACAGG + Intergenic
1186359712 X:8827863-8827885 TGATAAGAATGAAACTGGGCTGG + Intergenic
1186654085 X:11594125-11594147 TGAGAGAAATAAAGCTGAAGGGG - Intronic
1187005292 X:15226806-15226828 TGAGAGGAAAAAATCAGCACTGG + Intergenic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1188573620 X:31619260-31619282 TGAGAAGAATAAAATTGGAGAGG - Intronic
1189503339 X:41584983-41585005 TGAGAACAACAAAACTGGGCTGG + Intronic
1192330181 X:70169221-70169243 TGAGAGGAACAAGAGTGGAAAGG - Intergenic
1194422724 X:93696457-93696479 TGAGAGAAAGAACACTGGAAAGG - Intronic
1194751937 X:97694656-97694678 TGAGAGGAAGAAACCTTGAGCGG + Intergenic
1195137425 X:101923023-101923045 TGCCAGGAATAAAACTGTTCTGG + Intronic
1196048012 X:111276329-111276351 TGATAAGGAAAAAACTGGACAGG - Intergenic
1196342399 X:114610806-114610828 TGAGAGGAAAAAAATTGGAAAGG + Intronic
1196692755 X:118577906-118577928 TGGAAGGAGTCAAACTGGACAGG + Intronic
1197117819 X:122853730-122853752 GCAGAAGAATAAAACTAGACTGG + Intergenic
1200306872 X:155034875-155034897 TCAGAGGAAAAAAACTAGAGTGG - Intronic