ID: 1032007559

View in Genome Browser
Species Human (GRCh38)
Location 7:128315226-128315248
Sequence CTGTGTTATGGGAAGGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 417}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032007559_1032007568 19 Left 1032007559 7:128315226-128315248 CCATTCCCCTTCCCATAACACAG 0: 1
1: 0
2: 4
3: 46
4: 417
Right 1032007568 7:128315268-128315290 CCCAAAATTCAAAAGTCAGTAGG 0: 1
1: 0
2: 0
3: 64
4: 1368
1032007559_1032007570 22 Left 1032007559 7:128315226-128315248 CCATTCCCCTTCCCATAACACAG 0: 1
1: 0
2: 4
3: 46
4: 417
Right 1032007570 7:128315271-128315293 AAAATTCAAAAGTCAGTAGGTGG 0: 1
1: 0
2: 3
3: 52
4: 708
1032007559_1032007571 23 Left 1032007559 7:128315226-128315248 CCATTCCCCTTCCCATAACACAG 0: 1
1: 0
2: 4
3: 46
4: 417
Right 1032007571 7:128315272-128315294 AAATTCAAAAGTCAGTAGGTGGG 0: 1
1: 0
2: 1
3: 31
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032007559 Original CRISPR CTGTGTTATGGGAAGGGGAA TGG (reversed) Intronic
902060597 1:13638888-13638910 ATGTGTTATGGGAAGGCTAATGG + Intergenic
902237682 1:15068256-15068278 CTGGGTTCTGGGAGGGGGGATGG + Intronic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
903320038 1:22537585-22537607 GTGTGTGATGGGAAGTGGGAGGG - Intergenic
903406586 1:23102396-23102418 CTGTGTTGGGAGAAGGGGCAGGG - Intronic
903436860 1:23356402-23356424 CAGTCTTATGGGATTGGGAAAGG + Intergenic
905256441 1:36688482-36688504 AAGGGGTATGGGAAGGGGAAAGG + Intergenic
905256531 1:36688716-36688738 AAGGGGTATGGGAAGGGGAAGGG + Intergenic
905256654 1:36689050-36689072 AAGGGGTATGGGAAGGGGAAGGG + Intergenic
905392816 1:37648897-37648919 TTGTTTTCTGGGAAGGGGAGGGG - Intergenic
905444056 1:38013372-38013394 CTGTATAATGGGAATGGAAAAGG - Intronic
906151511 1:43590546-43590568 ATGTGTAATAGGCAGGGGAAGGG - Intronic
906300012 1:44674740-44674762 CTGTATTCTGGGAATGGGCAGGG + Exonic
906745516 1:48219524-48219546 AAGCTTTATGGGAAGGGGAATGG - Intergenic
907032201 1:51183550-51183572 GTGTATTTGGGGAAGGGGAAGGG + Intergenic
907948447 1:59157080-59157102 CTGTGTTCTTGGTGGGGGAAGGG - Intergenic
908486572 1:64600089-64600111 CTGTGAAATGGGTAGGAGAAAGG + Intronic
911057378 1:93720535-93720557 CTGTGGTCTGGGAAGGCGAGTGG - Intronic
911748563 1:101468612-101468634 CTGAGGAATGGGAAGGGGAAGGG + Intergenic
911855235 1:102868420-102868442 ATGAGATTTGGGAAGGGGAAAGG - Intergenic
912120422 1:106465067-106465089 CTGTTTTATTAGAAAGGGAAGGG + Intergenic
912557572 1:110527264-110527286 GTGGGGTATGGGATGGGGAAGGG + Intergenic
912630052 1:111239018-111239040 CTGAGTGTTGCGAAGGGGAAAGG + Intronic
912821687 1:112872785-112872807 CTGTGTTCTGGGAAAGGCAGAGG - Intergenic
913045802 1:115072677-115072699 CCGTGTGAGGGCAAGGGGAAGGG + Intronic
913171934 1:116241045-116241067 CTCTGTTATGGAGAGAGGAATGG + Intergenic
914677159 1:149914091-149914113 CAGGGGAATGGGAAGGGGAAGGG + Exonic
915534611 1:156527755-156527777 CTGTGTCAGGGCATGGGGAAAGG + Intronic
915732936 1:158066996-158067018 ATGTTTTATGGGAAGGACAATGG - Intronic
916124977 1:161561420-161561442 ATGTGTTATGGGAAGGATACTGG + Intergenic
916134871 1:161642765-161642787 ATGTGTTATGGGAAGGATACTGG + Intronic
916311018 1:163399037-163399059 CTGTGCTCTGGGAGGGGAAATGG - Intergenic
916801827 1:168223102-168223124 GTGTGTTAGGGGAAGGGAAAGGG + Intergenic
916984307 1:170174287-170174309 CTGTGATATGGTAAGCAGAAGGG - Intergenic
918136137 1:181675485-181675507 ATGTGTTAAGAGAAGGGGATGGG + Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920434819 1:205940924-205940946 CTGTGTTCTGGGAAGAGGAAAGG + Intronic
921670114 1:217915938-217915960 CAGTGTTTTGGTAAGGGGAATGG - Intergenic
921752452 1:218811668-218811690 GTGTGTTTTGGGAATGGCAAGGG + Intergenic
922339743 1:224645768-224645790 CCATGTTATGGGGTGGGGAATGG - Intronic
922351666 1:224739140-224739162 CAGTGTTGTGGGAAGTAGAAGGG + Intronic
922538573 1:226401891-226401913 CTGTGTGGTGGGAGGGGGAGGGG + Intronic
922584792 1:226725505-226725527 CTGTGTCATGGAAAGTGAAAGGG - Intronic
1063596050 10:7436625-7436647 CTATTTTATAGGAAGTGGAAAGG - Intergenic
1064991852 10:21263377-21263399 TTATGTTAGGGGAAAGGGAAAGG + Intergenic
1065416496 10:25493306-25493328 CTGGGTTATGCGAAAGGGAGAGG - Intronic
1067066140 10:43105339-43105361 CTGTCCTAGGGGGAGGGGAAGGG + Intronic
1067793000 10:49301821-49301843 CTGTCTTAGATGAAGGGGAAAGG + Intronic
1067836264 10:49643712-49643734 CTGGCTAATGGGAAGGGGAAAGG - Intronic
1069290307 10:66770725-66770747 AATTGTGATGGGAAGGGGAATGG + Intronic
1069801886 10:71086813-71086835 CTGTTTTATGTGCAGGGGGAAGG - Intergenic
1069878508 10:71577661-71577683 AAGGGATATGGGAAGGGGAAAGG + Intronic
1069991993 10:72321748-72321770 CTGTGATAGGGAAAGGGGGAGGG - Intergenic
1070312606 10:75284423-75284445 CTGGGTTGGGGGAAGGGGACTGG + Intergenic
1070376928 10:75841678-75841700 CAGTGTTATGCCAAGAGGAAAGG + Intronic
1070741583 10:78907048-78907070 CTGTGTGGAGGGAAGGGGACAGG - Intergenic
1072579149 10:96724890-96724912 CTGTGATGTGGCAAAGGGAAAGG - Intergenic
1072893375 10:99344849-99344871 CTTTGAACTGGGAAGGGGAAAGG - Intronic
1073271128 10:102265029-102265051 CTGTGGCATGGGATGGGGCATGG + Intronic
1074820736 10:117176302-117176324 CTGTCTTGAGGGCAGGGGAAAGG - Intergenic
1077469175 11:2748796-2748818 CTGTGTTCTGGCCAGGTGAATGG + Intronic
1077878283 11:6325992-6326014 CTGTGCTCTGGGGAGGGGATGGG - Intergenic
1078673039 11:13381961-13381983 CTGTTTTAGGAGATGGGGAAAGG - Intronic
1080556901 11:33426334-33426356 CTGTTTTATGGGAAGTAGAGGGG + Intergenic
1081169904 11:39854436-39854458 CTGTGTTATGGAAAGGGATATGG + Intergenic
1081259616 11:40943646-40943668 TTGTTTTCTGTGAAGGGGAAGGG + Intronic
1081655227 11:44852798-44852820 GTTTGTCAGGGGAAGGGGAAAGG + Intronic
1081713527 11:45233195-45233217 CTGTGCTGTGCAAAGGGGAAGGG + Intronic
1082715156 11:56603241-56603263 CTGTGGAAAGGGAAGGGGAGAGG - Intergenic
1083072248 11:59997106-59997128 CTGTATTTTGTGAAGGGTAAAGG + Intergenic
1083118362 11:60486735-60486757 TAGTCTTCTGGGAAGGGGAATGG - Intergenic
1084456031 11:69268768-69268790 CTGTGTGGTGGGAAGGAAAATGG + Intergenic
1085923803 11:80990557-80990579 CAGTGCTATGAGAAGGGGCAAGG - Intergenic
1087920352 11:103860034-103860056 CTGCGTTATTGTAATGGGAATGG + Intergenic
1088781251 11:113136327-113136349 ATGAGTTATGGGAGGGGAAAAGG + Intronic
1089690792 11:120185574-120185596 CTGTGGTGTGGGGTGGGGAAGGG - Intergenic
1089743344 11:120600124-120600146 GTGTGTTTGGGGAAAGGGAAAGG + Intronic
1090076707 11:123584366-123584388 CTGAGAAATGGGAGGGGGAATGG + Intronic
1090135961 11:124199505-124199527 ACGTGGGATGGGAAGGGGAAGGG - Intergenic
1090367844 11:126222824-126222846 CTATGCTATGGGATGGGGATAGG + Intronic
1091055709 11:132416967-132416989 CTCTGTTTTGGGAAGGGGAAGGG + Exonic
1091755925 12:3051493-3051515 CTCTGTCAAGGGAAGGGGAGAGG - Intergenic
1091822864 12:3489749-3489771 CTGTGTTCTGAGAAGGGAAAAGG + Intronic
1095943009 12:47738615-47738637 CTGTGGCCTGGGAAGGGGCAGGG - Intronic
1096464059 12:51838507-51838529 CTGAGTCATGGGAGGGGGAAGGG - Intergenic
1096546182 12:52341643-52341665 CTGTGGCTTAGGAAGGGGAAAGG + Intergenic
1096713461 12:53475661-53475683 CTGTGTGCTGTGAAGGGTAAAGG + Intronic
1096760488 12:53837682-53837704 GTTAGTTTTGGGAAGGGGAAAGG - Intergenic
1098031707 12:66261449-66261471 CTGTTTTATTGGAATTGGAATGG + Intergenic
1098253765 12:68595513-68595535 CTGTGTTTTGGGGAGGGGCAGGG - Intergenic
1099207915 12:79749145-79749167 CTGTGATGGGGGAAGAGGAAGGG + Intergenic
1099317228 12:81099567-81099589 CTTTGTTATTGGAATGGGAGAGG + Intronic
1100239274 12:92694553-92694575 CTGTGTTGGGGGAAGGGAAAAGG + Intergenic
1101857941 12:108459577-108459599 CTGTTTTCTGGGAAGGGGACTGG - Intergenic
1102352474 12:112204290-112204312 CTGAGTTCTGGGAAGTGGGAAGG + Intronic
1102425492 12:112840936-112840958 GTGTGTGATGTGAATGGGAATGG - Intronic
1102668085 12:114593245-114593267 CTGTATTATGGCTTGGGGAAAGG + Intergenic
1103867497 12:124064492-124064514 CTGTGTTTTGGGAAAGGGGAGGG + Intronic
1104238381 12:126961621-126961643 TTTTGATATGGGAAGGGGACAGG - Intergenic
1104545995 12:129713464-129713486 GTGTGTTTTGGGAAGGAGGAGGG + Intronic
1104917841 12:132275202-132275224 ATGTTTTATGGGAAGGAGGAGGG - Intronic
1105858386 13:24390429-24390451 CCGTGTCATCTGAAGGGGAATGG - Intergenic
1106087043 13:26551991-26552013 TTGGGTTGTGGGAATGGGAAAGG + Intergenic
1106173925 13:27312229-27312251 AGGAGTTATGGGAAGAGGAAGGG - Intergenic
1106372953 13:29154480-29154502 CTGTGTTGTGAGAAGGTTAATGG - Intronic
1106479749 13:30128328-30128350 GTGTATTCTGGGTAGGGGAATGG - Intergenic
1108100328 13:46947500-46947522 AAGAGTTATGGGAAGGAGAAAGG + Intergenic
1108198081 13:48015104-48015126 CAGTGTAATGGCTAGGGGAAAGG + Intergenic
1109555073 13:63962766-63962788 CAGAGTTATGGGAAGAGCAAGGG - Intergenic
1110434034 13:75459259-75459281 CAGTGTTGTGGGGAAGGGAAAGG - Intronic
1112649761 13:101382287-101382309 TTGTGTTATGGGGAGGGGGGCGG + Intronic
1113278421 13:108761248-108761270 CTGTATTTTGGGAAGGGTCAAGG - Intronic
1114230566 14:20778031-20778053 ACGAGTTATGGGAAGGTGAAGGG - Intergenic
1114411059 14:22500893-22500915 CTGTGTTATGTCCTGGGGAAGGG + Intergenic
1114412913 14:22517599-22517621 CTGTCTTTTGGGAAGGGGCTCGG - Intergenic
1115362959 14:32524298-32524320 CTCTGTGATGGAAAGGGGACAGG + Intronic
1115829559 14:37320668-37320690 CAGTGCTATGGGAATGGCAAGGG - Intronic
1115887828 14:37993622-37993644 CAGTGCTATGGGAAGGGAATAGG - Intronic
1116372131 14:44149717-44149739 CTGGCTGGTGGGAAGGGGAAAGG + Intergenic
1116425202 14:44782388-44782410 CTGTGTTATAGGTATGTGAAAGG - Intergenic
1117572534 14:57062102-57062124 CTCTGTTTTGGGAAAAGGAAGGG - Intergenic
1118033241 14:61838765-61838787 CTATGTTATTGGAAGGGAGAAGG + Intergenic
1118383988 14:65240038-65240060 CTGTGCTAATGGAAGGGGAGTGG - Intergenic
1118811963 14:69281723-69281745 CTGTGTGCTGGGATGGAGAAAGG - Intronic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119482120 14:74964468-74964490 CTGTGTGCAGGGGAGGGGAAGGG + Intergenic
1120403783 14:84068645-84068667 CTGTGTTATGGGATTCAGAAAGG + Intergenic
1120818070 14:88883883-88883905 CTGTTTTAAGGGAAGGGGCCGGG - Intergenic
1121260656 14:92563763-92563785 CTGTGCTATGCTAATGGGAAAGG + Intronic
1121288464 14:92755162-92755184 CTGTGCAACTGGAAGGGGAAAGG - Intergenic
1121496184 14:94392673-94392695 CTGTGTGTTGGGGAGGGGAGGGG + Intergenic
1121687895 14:95852767-95852789 CTGTGTTTTGGGCAGGAGGATGG + Intergenic
1122040072 14:98981119-98981141 CAGGGTTGGGGGAAGGGGAATGG + Intergenic
1122292832 14:100688643-100688665 CGGTGTTACGGTAAGGGGAGTGG - Intergenic
1124949146 15:34300465-34300487 CTGTGTTATGGCTAGGGGTAGGG - Intronic
1125138047 15:36367178-36367200 CCCTGTTATTGGGAGGGGAAGGG - Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125461335 15:39909591-39909613 CTTTGTTTTGGGAGAGGGAAGGG - Intronic
1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG + Intronic
1128831096 15:70769470-70769492 TTCAGTTATGGGAAAGGGAAAGG + Intergenic
1128999257 15:72319461-72319483 CTGTGATCTGGGAAGGGGGCTGG + Intronic
1129616912 15:77105937-77105959 CTGGGTGATGTGATGGGGAAGGG + Exonic
1129660145 15:77548820-77548842 CTGTGTGAAGGGTGGGGGAAGGG + Intergenic
1133216723 16:4297111-4297133 ATGTGTCATGGGAGGGGGACAGG + Intergenic
1133728899 16:8561221-8561243 CTGTGCTATAGGCAAGGGAAGGG - Intergenic
1134105036 16:11479113-11479135 CTGTACTTTGGGAGGGGGAAGGG + Intronic
1135774170 16:25241805-25241827 CTGTGGCATGGGATGGGGAGAGG + Intronic
1135843087 16:25894209-25894231 CTGTGTTCTGTGAAGGGGGCAGG + Intronic
1135983586 16:27167457-27167479 GTGGGATAAGGGAAGGGGAAAGG + Intergenic
1136045734 16:27613592-27613614 CTGTGTTCTGGGAAGATGCATGG + Intronic
1137390342 16:48075973-48075995 CTATGTTATGGGGAGAGAAATGG - Intergenic
1138227294 16:55307628-55307650 CCATATCATGGGAAGGGGAATGG + Intergenic
1138257183 16:55576133-55576155 CTTGGTTTGGGGAAGGGGAAGGG + Intronic
1138328330 16:56192821-56192843 GTGTTTTTTGGGAGGGGGAAGGG + Intronic
1138358534 16:56405988-56406010 CTGTCAGAAGGGAAGGGGAAGGG + Intronic
1138939997 16:61778488-61778510 TTTTGTTGTGGGAAGGGGCAGGG + Intronic
1139750769 16:69107638-69107660 CTGCGCTCTGGGTAGGGGAAGGG - Exonic
1141115213 16:81302762-81302784 CTAGGTTTTGGGAAGGAGAAAGG - Intergenic
1141396273 16:83707947-83707969 CTGTGAGTTGGCAAGGGGAATGG + Intronic
1142523023 17:518370-518392 CTGTGTTATGAGAAGGAGTCTGG - Exonic
1143197380 17:5086382-5086404 ATGTGGTAAGGGAAGGGGAAAGG - Intronic
1143548658 17:7615114-7615136 CAGTGTTGTGGGGCGGGGAAAGG - Intronic
1144630291 17:16868382-16868404 ATGAGCTAAGGGAAGGGGAATGG + Intergenic
1145957046 17:28861774-28861796 GTGGGTTATGGGAAGGGGACTGG + Intergenic
1146918732 17:36695509-36695531 CTGTGTGATAGGGTGGGGAAGGG + Intergenic
1147167571 17:38601591-38601613 CTGTGGTGTGGGGAGGGGGATGG + Intronic
1147306371 17:39567042-39567064 CTCTGCTTTGGGAGGGGGAAGGG + Intergenic
1147310523 17:39593420-39593442 CTGTGTCCAGGGAAGGGGCAGGG + Intergenic
1147887732 17:43696055-43696077 CTCTCTTAGGGAAAGGGGAAGGG - Intergenic
1148479451 17:47950466-47950488 CTGTGTAGTGGGACGGGGTAGGG + Intergenic
1148855632 17:50577854-50577876 CTGGCTTCTGGGAAGGGGAAGGG + Intronic
1149835214 17:59906365-59906387 CTGTCGAAAGGGAAGGGGAAGGG - Intronic
1150072527 17:62163960-62163982 CTGTGGTAGGTGAAGGGGCAAGG - Intergenic
1150268313 17:63845334-63845356 CTCTGAGATGGGAAGGGGATGGG - Intergenic
1150280240 17:63925866-63925888 CTGTGTTCTGGGGAGGGGGCAGG + Intergenic
1150478619 17:65492386-65492408 ATGTGTGATGGGGAAGGGAATGG - Intergenic
1150487503 17:65554147-65554169 CTGGTTTATGGGGAGGGGCAGGG - Intronic
1151064490 17:71134714-71134736 CTGTGGCATGGGTAGGGCAATGG - Intergenic
1152095946 17:78271669-78271691 CTGAGATATGTGGAGGGGAAGGG + Intergenic
1152710544 17:81868786-81868808 CTTTGGTATGGGGAGGGGAGGGG + Exonic
1153405395 18:4733054-4733076 CAGTCTTAGGGGAAGGAGAAGGG - Intergenic
1155110699 18:22711279-22711301 CTGTGACTTGGGAAAGGGAAGGG - Intergenic
1155490699 18:26398844-26398866 CTGTGTTATTGGAGAAGGAAAGG + Intergenic
1156049662 18:32917243-32917265 ATGAGTGATGGGAAGGGAAAAGG - Intergenic
1156496012 18:37525427-37525449 CTGGGTTGTGGGGAGGGGAGTGG + Intronic
1156614878 18:38771880-38771902 CTGTGTTGTGGGACGGAGAGGGG - Intergenic
1157267712 18:46242573-46242595 CTTTGGCATGGGAAGGGCAAAGG - Intronic
1157396610 18:47346851-47346873 CAGTGTTACGGGCAGAGGAATGG + Intergenic
1157570894 18:48711596-48711618 CTGTGTCATGGGGGGAGGAAGGG - Intronic
1159084218 18:63769969-63769991 CAGTGTGAGTGGAAGGGGAAGGG + Intronic
1160226519 18:77016285-77016307 CTGTGGTCTGAGAAGTGGAAGGG - Exonic
1160830848 19:1104342-1104364 CTGGGGTCGGGGAAGGGGAAGGG + Intronic
1161141207 19:2649054-2649076 TTATGTTCTGGGAAGGGGGAAGG + Intronic
1162821364 19:13225449-13225471 CTGTGCAATGGCAGGGGGAAGGG + Intronic
1162873771 19:13605752-13605774 CTGTGAAATGGGAAGAAGAATGG - Intronic
1163418713 19:17202411-17202433 CTGTGGTATGGGCAGGGCATGGG - Intronic
1164601705 19:29567168-29567190 ATGTGTGATGGCATGGGGAAGGG + Intergenic
1164857616 19:31537274-31537296 CTGGGTTATGGGAGGGTGAGAGG - Intergenic
1165351701 19:35279307-35279329 CTGTGCTAAGGGCTGGGGAAGGG - Exonic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1165538750 19:36472743-36472765 GTGTGTTAGGTAAAGGGGAAAGG + Intronic
1166702327 19:44889240-44889262 CTGTGGGATGTGAAGGGGATGGG + Intergenic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167776806 19:51563936-51563958 CTGGATTCTGGGCAGGGGAAGGG - Intergenic
925250591 2:2433825-2433847 ATGTGATAGAGGAAGGGGAAGGG + Intergenic
925732675 2:6931438-6931460 CTGGGTTTTGGGAATGGGGAGGG + Intronic
926047977 2:9724246-9724268 CTGTGTCTTGGGAAGGAGCATGG - Intergenic
926572191 2:14541883-14541905 CAGTGTTGTGGGAAAGGGAAGGG + Intergenic
926853515 2:17227018-17227040 CTGTATTCTGGGAAAGGGTATGG + Intergenic
927955700 2:27205989-27206011 CCGTGGTGTGGGGAGGGGAAGGG - Intronic
929294031 2:40226177-40226199 CTGGGCAATGGGAAGGGCAAAGG + Intronic
929427127 2:41854945-41854967 CTTGGCAATGGGAAGGGGAAGGG - Intergenic
931321553 2:61177968-61177990 CTGTGTTAGGGGCGGGGGTATGG + Exonic
931486645 2:62700425-62700447 CTATGTTGGGGGAAGGGGATGGG + Intronic
932047955 2:68368913-68368935 CAGGGTGATGGGAAAGGGAAGGG + Intronic
932723410 2:74157133-74157155 CTGTGATCTGGGAAGGGGAGAGG - Intronic
934751752 2:96798296-96798318 TTGTGGAATGGGAAGGAGAAGGG + Intronic
935024068 2:99259523-99259545 CTGTGGTTTGGAAAGGAGAAGGG + Intronic
936088572 2:109486716-109486738 ATGTGTTAGAGGAAGGGGAGGGG + Intronic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
938311864 2:130295897-130295919 CTTTGCAACGGGAAGGGGAAGGG - Intergenic
938589711 2:132724585-132724607 CTGTGATAGATGAAGGGGAAGGG - Intronic
938995876 2:136677165-136677187 CAGTGTTATGGGAAAGAAAAGGG + Intergenic
939394612 2:141612735-141612757 CTGAGTGATGCGAAGGCGAAAGG - Intronic
940234701 2:151497440-151497462 CTGTATTATAGAAATGGGAATGG + Intronic
940395644 2:153187398-153187420 CTGACTTGGGGGAAGGGGAAAGG + Intergenic
940515148 2:154675038-154675060 ATGTGTTAATGGACGGGGAAGGG + Intergenic
940727266 2:157348225-157348247 CAGTGATATGTGAAGGAGAAAGG - Intergenic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
941379880 2:164779568-164779590 CTGTGTTCTGGGAAATGGCATGG - Intronic
941662978 2:168214504-168214526 CTGTTTCATGGTATGGGGAATGG + Intronic
941930523 2:170934554-170934576 CTGTGTTAGGGGATGAGGTAGGG - Intronic
943721318 2:191206244-191206266 AGGTGTGATGGGAAGAGGAAGGG - Intergenic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
945730357 2:213524931-213524953 CTGTGATTTGGGAAGGGTCAGGG + Intronic
947063458 2:226192987-226193009 CTGTCTGGTGGGAAGAGGAATGG + Intergenic
947132358 2:226941778-226941800 CTGTGTTATGGGTATGTGCATGG - Intronic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947543117 2:230991912-230991934 CTGTGTGACGTGAAGGTGAAGGG + Intergenic
948219510 2:236258449-236258471 TGGTGTAATGGGAAGGGCAAGGG - Intronic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
1168935130 20:1658404-1658426 GTGGGTTATGGAAAGGGGATAGG + Intergenic
1169260906 20:4137141-4137163 CGGTGGTATGGGCTGGGGAAGGG + Intronic
1170602814 20:17854569-17854591 CTGTGTGATGGGGATGAGAAGGG + Intergenic
1172032427 20:31991294-31991316 CAGAGCCATGGGAAGGGGAAGGG + Intronic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1172175227 20:32968127-32968149 CTGGGTGATGGAGAGGGGAAGGG + Intergenic
1173404430 20:42752594-42752616 CTGTGTTATGGGATGGGATCTGG - Intronic
1174465355 20:50712967-50712989 CTATGCTAAGGGAGGGGGAAGGG + Intergenic
1175283468 20:57820893-57820915 AAGGGTGATGGGAAGGGGAAGGG + Intergenic
1175770877 20:61623360-61623382 CTTTGTGATGGGGTGGGGAAAGG - Intronic
1176028413 20:62998111-62998133 CTGTGTCCTGGGAATTGGAATGG + Intergenic
1179122481 21:38560581-38560603 GTGTTTTATTGGAGGGGGAAGGG - Intronic
1179315253 21:40238218-40238240 CTGTGGTCTGGAAAGTGGAATGG + Intronic
1180411743 22:12617976-12617998 CTGTGTTTTGGGAAGGCAATGGG - Intergenic
1182409158 22:30167958-30167980 GTGTGTGATGGGAGGGGGAGTGG - Intronic
1183090139 22:35516741-35516763 CTGTGTTGTGGGAGTGGGCAGGG - Intergenic
1183353867 22:37348397-37348419 CTGTGTTAGGGGGCAGGGAAGGG + Intergenic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1183404723 22:37624856-37624878 GTGTGTGAGGGGAAGGGAAAGGG - Intronic
1183896349 22:40972287-40972309 CTGTAAGATGGGGAGGGGAAAGG + Intronic
1184097478 22:42324243-42324265 CATTATTATTGGAAGGGGAAGGG + Intronic
1184252248 22:43267553-43267575 CTGTGTTAAGTGAGGGGGAAGGG - Intronic
1184768632 22:46585721-46585743 CTGGTCTATGGGATGGGGAAGGG + Intronic
949366303 3:3285246-3285268 GTGTGTTAAGGGTAGGGAAAAGG + Intergenic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
950412464 3:12848027-12848049 CTGTTTTATGTGTAGGGGGAGGG - Intronic
951827955 3:26889420-26889442 ATGAGCTATGGAAAGGGGAACGG + Intergenic
951877112 3:27439784-27439806 CTGTGATTTGGGAAAAGGAAAGG - Intronic
952843876 3:37670388-37670410 CTGTCCTATGGGAAGGTGAGTGG - Intronic
952855524 3:37767361-37767383 CTGCCTTAAGGGATGGGGAAAGG + Intronic
953660479 3:44888015-44888037 CTTTGAAATGGAAAGGGGAAGGG - Intronic
953990803 3:47481698-47481720 CTTTGGTTTGGCAAGGGGAAGGG + Intergenic
954514364 3:51159133-51159155 GTATGTTATAGGCAGGGGAAGGG - Intronic
955567086 3:60258935-60258957 GGGTCTTATGAGAAGGGGAAGGG + Intronic
956013762 3:64859260-64859282 ATGTGTTATGGGAAAGGCAAGGG + Intergenic
956056158 3:65301050-65301072 GTGAGGTATGGGAAGGGGTATGG + Intergenic
957243812 3:77692901-77692923 GTGTGTGTTGGGAAGGGGAGTGG - Intergenic
958017076 3:87950675-87950697 ATTTGGTATGGGAAGAGGAAAGG + Intergenic
958187317 3:90138567-90138589 CTGTATTCTGGGAAGTAGAATGG - Intergenic
958433664 3:94071950-94071972 GTGTGTTGTGGGGAGGAGAATGG + Intronic
958940089 3:100302168-100302190 CTGTTTTATGGGCAGTGGCAGGG + Exonic
958951077 3:100416874-100416896 CTGGGTTAGGGGAAAGGGGAGGG - Intronic
961716812 3:128863531-128863553 CTGTTTTATGTGTAGGGGGAGGG + Intergenic
961864825 3:129945997-129946019 CTGTGAAATGGGAGGGTGAATGG - Intergenic
966434533 3:179868771-179868793 ATGCGTTATGGGAGGGAGAAAGG - Intronic
966621348 3:181967662-181967684 CAGTGCTATAGGAAGGAGAAAGG + Intergenic
967032911 3:185624961-185624983 CTGTGTTCTGGTATGGGAAATGG + Intronic
967387511 3:188926127-188926149 TTGTGGGATGGGAAGGGAAAAGG - Intergenic
967790937 3:193548332-193548354 GGGTGTAATGGGAAGGGGAAGGG + Intronic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
968841964 4:3014167-3014189 CTGTGATAAGGGAAAGGAAAGGG - Intronic
969180249 4:5435171-5435193 CAATGTTTTGGTAAGGGGAATGG - Intronic
971382137 4:26108697-26108719 CTATGTTCTGGTAAGGGGAGTGG + Intergenic
972503552 4:39698752-39698774 GTGGGTTGGGGGAAGGGGAAAGG + Intronic
972912931 4:43841177-43841199 CTGGCTTAGAGGAAGGGGAAGGG - Intergenic
972914766 4:43861907-43861929 CAGTGTTAGGGGTAAGGGAAGGG + Intergenic
972942497 4:44214051-44214073 CTAAATTATGGGAAGGTGAAGGG - Intronic
973578055 4:52312772-52312794 CTCTTTTATGGGAATGGAAAGGG + Intergenic
976064369 4:81166984-81167006 CTGTGTTAAGGGGTGGAGAAAGG - Intronic
978417258 4:108489564-108489586 CTGGGCTTTGCGAAGGGGAAGGG - Intergenic
978839914 4:113199797-113199819 CTGTGTTATCAGAAAGGCAAAGG - Intronic
979096125 4:116553427-116553449 CTGTGGTGTGGGGAGGGCAAAGG + Intergenic
980563629 4:134508849-134508871 GTGGGTTAGGGGAAGTGGAATGG - Intergenic
981393850 4:144222784-144222806 TTTTGTTAAAGGAAGGGGAATGG + Intergenic
981539148 4:145831066-145831088 CTGTGGTATTGAAAAGGGAAGGG - Intronic
982449569 4:155536302-155536324 CTCTGTTATGCTCAGGGGAAAGG + Intergenic
984637979 4:182134416-182134438 CTGAGTTAGGGGAAAGAGAAGGG - Intergenic
984871199 4:184326782-184326804 GTAAGTTATGGGAAGGTGAAGGG - Intergenic
985625345 5:982618-982640 CTGTGTTGTGGGGAGGGGCCGGG + Intergenic
985759895 5:1743106-1743128 CTGTGCTTTAGGCAGGGGAAAGG - Intergenic
986145550 5:5073984-5074006 CTGGCTTATGGGAAGGGACAGGG - Intergenic
986758190 5:10857005-10857027 CTGTGTCATCGGCAGGGCAAAGG - Intergenic
986831304 5:11581849-11581871 GTGGGGCATGGGAAGGGGAAGGG + Intronic
986872678 5:12068414-12068436 TTGGGTAAAGGGAAGGGGAAGGG + Intergenic
987003265 5:13682545-13682567 CTGTGTTTTCTGAAGGGCAAAGG + Intergenic
988728893 5:33950565-33950587 CTAGGTAAAGGGAAGGGGAAGGG + Intronic
989619259 5:43368524-43368546 GAGTGCTATGGGAATGGGAAAGG - Intergenic
989718954 5:44502277-44502299 CTGCAATAGGGGAAGGGGAAAGG - Intergenic
990449428 5:55920809-55920831 CTTAGCTATGGGAAGGGGACAGG - Intronic
992087890 5:73294473-73294495 TTGGGGGATGGGAAGGGGAAAGG + Intergenic
992207872 5:74448596-74448618 TTGTGCTATGGGAAGGAGAAAGG + Intergenic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
993088018 5:83387979-83388001 ATGAGTTATGGGAAGGAAAAAGG - Intergenic
994335720 5:98563477-98563499 CTGTGTTTGGGGATGGAGAAAGG - Intergenic
994774841 5:104028129-104028151 GAGGGTTTTGGGAAGGGGAAAGG - Intergenic
996999949 5:129747604-129747626 CTTTGTTCTGGGGAGGGAAATGG - Intergenic
998173994 5:139889643-139889665 GTTTGTAATGGGAAGGGGGAGGG - Intronic
998186154 5:139981496-139981518 CTGTGTTAAGAGAAGGGAAACGG - Intronic
999039568 5:148392405-148392427 CTTTGTTTTGGGGAGGGGGAGGG + Intronic
999123849 5:149231414-149231436 GTGTGTTGGGGGATGGGGAATGG + Intronic
999670685 5:153956838-153956860 CTGTGTTATGGGCAGAGAAAGGG - Intergenic
999713700 5:154341909-154341931 CTGGCTCATGGGATGGGGAAAGG - Intronic
1001024273 5:168210288-168210310 CTATGTTGGGGGAAGGAGAAGGG - Intronic
1001329588 5:170752740-170752762 CTGTGTTCAGGGAAGAGGAGAGG - Intergenic
1001714347 5:173802775-173802797 CTGAGATATGAGAAGGGGACAGG - Intergenic
1002055075 5:176594101-176594123 CTGTGGACTGGGAAGGGGCAGGG + Intronic
1002439007 5:179254372-179254394 CTATGAGCTGGGAAGGGGAATGG + Intronic
1002451354 5:179320620-179320642 CTGTGCTATCAGAAGGAGAAGGG - Intronic
1002999538 6:2318312-2318334 GTGAATTATGGGAAGGGGCATGG + Intergenic
1003011884 6:2434251-2434273 CTGTGTCATGGGAATGAGGAAGG + Intergenic
1003435000 6:6080113-6080135 GTCTTTTATGGCAAGGGGAAAGG + Intergenic
1005024087 6:21446356-21446378 CTCTGTAATCGCAAGGGGAAGGG - Intergenic
1005368082 6:25099584-25099606 CTGTGTGATGGCAAAGGGAAAGG - Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006934075 6:37705385-37705407 CTGCGGTATTGGAAGGGGAGGGG + Intergenic
1007093639 6:39200076-39200098 CTGGGTTAGGGGAAGGGACATGG + Intronic
1008022040 6:46589835-46589857 CTTTGCGGTGGGAAGGGGAAGGG - Intronic
1008605665 6:53137107-53137129 CTGTGGTTTGGGAAGGGGGAAGG + Intronic
1009807519 6:68621427-68621449 CTTTGTTATAGGAAAGGGAAAGG - Intergenic
1010022540 6:71177497-71177519 ATGGGTCATGGGATGGGGAAAGG - Intergenic
1012232365 6:96775097-96775119 CTCTGTTAAGGGAAGGGTCAAGG + Intergenic
1012232752 6:96779607-96779629 CTCTGTTAAGGGAAGGGTCAAGG + Intergenic
1012266197 6:97146341-97146363 CTGTGTTTTTGGTGGGGGAAAGG - Exonic
1012924308 6:105252170-105252192 TTGAGTTAGGGGAAGGGGTAGGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013852977 6:114538043-114538065 CTGTGTTATGGAGAGGGCAAGGG - Intergenic
1014616034 6:123600547-123600569 CTTTATTATGGGAAAGGGATGGG + Intronic
1015503932 6:133962095-133962117 GTCTGTTATTGGAAGAGGAATGG + Intronic
1015693584 6:135955269-135955291 AGGTCTTACGGGAAGGGGAAGGG + Intronic
1016524633 6:144987489-144987511 TTGTGTTCTCTGAAGGGGAAAGG - Intergenic
1016922516 6:149309840-149309862 GTGTGTCCTGGGAAGGGAAATGG - Intronic
1017248086 6:152249388-152249410 CTGTGCTATGGGAAGGTAAAAGG + Intronic
1017903564 6:158739001-158739023 CTGTGTGAGTGGGAGGGGAAAGG - Intronic
1018742357 6:166739862-166739884 CTGTGTTACGGAAAGGGGTTGGG - Intronic
1018743497 6:166747583-166747605 CTGTGTGGTGGAAAGGGGGAAGG - Intronic
1018744209 6:166749876-166749898 CTGTGTGGTGGAAAGGGGGAAGG - Intronic
1019116880 6:169772156-169772178 CTGTGTTACGACAAGGTGAAGGG - Intronic
1019255119 7:44746-44768 CTGTGAAATGGGAACAGGAATGG - Intergenic
1019425052 7:971049-971071 CTGGGTTGTGGGGAGGGTAAAGG - Intronic
1020500841 7:8918246-8918268 AAGTGTTTTGGGAATGGGAAAGG - Intergenic
1023206280 7:37753353-37753375 CTGTGGTATGGGCATAGGAAAGG + Intronic
1023531557 7:41161869-41161891 CAGTGTTATGGGAAGACAAATGG + Intergenic
1023929210 7:44694783-44694805 CAGTGTTTTGGGGAAGGGAAGGG + Intronic
1024049495 7:45609773-45609795 CTGAGGTCTAGGAAGGGGAAAGG + Intronic
1024996288 7:55275326-55275348 CTGTGCAGTGGGAAGGGAAAGGG - Intergenic
1026101838 7:67390270-67390292 CTGTGCTGTGGGAAGGGGAGGGG - Intergenic
1027336642 7:77157923-77157945 CTGTGCTATGGGTAGGAGATAGG - Intronic
1027338112 7:77175961-77175983 CAGTGTTATCAGAAGGGAAAGGG + Intronic
1027592384 7:80133826-80133848 CTGTGATATCTGTAGGGGAAAGG + Intergenic
1027605893 7:80298055-80298077 CTGTTTTATGGCATGGGGAAAGG - Intergenic
1028079704 7:86559860-86559882 CTGTGTTATGGTTAGGGGAGTGG - Intergenic
1028743113 7:94298696-94298718 ATGGGCTATGGGCAGGGGAAGGG - Intergenic
1029432450 7:100539727-100539749 CGGTGTGGTGGGGAGGGGAAAGG + Intronic
1029777615 7:102694832-102694854 CAGTGTTATCAGAAGGGAAAGGG - Intergenic
1029779148 7:102713186-102713208 CTGTGCTATGGGTAGGAGATAGG + Intergenic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1032498098 7:132377936-132377958 CTGTGGTATGGGAGAGGCAATGG + Intronic
1033360801 7:140637767-140637789 CTGTGGTCTGAGAAGGGGACAGG - Intronic
1033418584 7:141185812-141185834 CTGTGATATGGAAAGGGGGAAGG - Intronic
1033567872 7:142597405-142597427 CTGTTTTATGGGCAGGGGGCAGG - Intergenic
1035417949 7:158705134-158705156 CGGTGTTGTGGGAAGGAGGAAGG + Intergenic
1036079943 8:5544062-5544084 CTTTGATATGTGACGGGGAAAGG + Intergenic
1037223488 8:16554538-16554560 CTGAGGTCTGGGAAGGGGAGGGG + Intronic
1037895667 8:22652515-22652537 ATGTGTGGTGGGGAGGGGAAGGG + Intronic
1038005605 8:23427362-23427384 CTGTGTGACTGGAAGGGGAAAGG - Intronic
1039140452 8:34381626-34381648 CTATGTTATGGTAATGGGAATGG + Intergenic
1040389234 8:46935431-46935453 CTGTGTGGTGGGAAGGGCAAGGG - Intergenic
1040482898 8:47842259-47842281 CTGTGCTGGGGGTAGGGGAAGGG - Intronic
1040547392 8:48409279-48409301 CTGTGTTATGGTAAGTGGGAAGG - Intergenic
1042140748 8:65676142-65676164 GTGTGTGTTGGGAAGGGGGAAGG - Intronic
1042841064 8:73124347-73124369 TTGTGTTAGTGGATGGGGAAAGG - Intergenic
1043134573 8:76505369-76505391 CTGAGTTATGGGAATAGGACTGG - Intergenic
1043871175 8:85434783-85434805 GTGTGCTATGGGAAGAGTAAAGG + Intronic
1044130440 8:88517159-88517181 CTGCGTTATGGAAATAGGAAAGG - Intergenic
1044738494 8:95302315-95302337 CTGTGAAATGGGAATGGAAAGGG + Intergenic
1044952956 8:97451435-97451457 CTGTGTTGTGGGAAGGTTACCGG - Intergenic
1045511684 8:102816469-102816491 CTGTATTATTAGAAAGGGAAAGG + Intergenic
1045717659 8:105067273-105067295 TTGTGATATGGGAGGGGGCAGGG - Intronic
1046190161 8:110784775-110784797 CTATGTTAGTGGAAGGTGAAGGG + Intergenic
1046582687 8:116112527-116112549 CTGTAGTTTGGGAAAGGGAAAGG - Intergenic
1046827185 8:118704155-118704177 CTCTGTTATGGGAAGAGAGAAGG - Intergenic
1047020013 8:120765392-120765414 CTACGTTATAGGAAGAGGAAGGG - Intronic
1047444519 8:124907316-124907338 CTCCCTTAGGGGAAGGGGAACGG + Intergenic
1048159250 8:131997456-131997478 CTATGTAATGGGAAGTTGAATGG - Intronic
1048218102 8:132515274-132515296 GGGTCTTCTGGGAAGGGGAAGGG + Intergenic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1049136784 8:140909166-140909188 CTGTTGGAAGGGAAGGGGAAGGG + Intronic
1050131885 9:2421405-2421427 CTGTGTGCTGGGAATGGAAATGG + Intergenic
1051323836 9:15942440-15942462 CTTTCTTAAGGGAAGGAGAAAGG + Intronic
1051813227 9:21074549-21074571 GTGTGATATGGGAAGGGGGAAGG + Intergenic
1052365343 9:27606469-27606491 CTTTGTAATGGTAAGGAGAAAGG - Intergenic
1053396278 9:37777322-37777344 CTGTGGCCTGGGATGGGGAAGGG - Intronic
1053430969 9:38041497-38041519 ATGGGTGATGGGAAGGAGAAGGG + Intronic
1053443822 9:38136400-38136422 CTGTTAGATGGGAAGGGAAAGGG - Intergenic
1054882104 9:70154957-70154979 CTGTGTTGTGGGGCAGGGAAAGG - Intronic
1055202941 9:73689747-73689769 GTGTGTTTGGGGGAGGGGAAAGG + Intergenic
1055259186 9:74412547-74412569 CTGTGTTGAGGGAGGGGGCAGGG + Intergenic
1055762922 9:79628739-79628761 TTGTGTGATGGGCAGGGGAAGGG + Intronic
1055890434 9:81117965-81117987 CTGAGTTAAGGGAAGGACAATGG - Intergenic
1056311109 9:85341877-85341899 CTGTGTTAAAGGAAGGTGAATGG - Intergenic
1056377385 9:86028061-86028083 CGGTGATATGGGAGGGGGACAGG + Intronic
1056838336 9:89976376-89976398 CTCTATTATGGGAGGGTGAAGGG - Intergenic
1057913562 9:99038497-99038519 CTGTTTTATAAGAAGGGGGAGGG + Intronic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058649189 9:107159230-107159252 CTGTGTTGTGGGAAGGACAGGGG + Intergenic
1058666018 9:107316579-107316601 TTGTTTTATGGGATGGGAAAAGG + Intronic
1059486155 9:114628468-114628490 CTGTGTTTTGGGAATGTGAGAGG + Intronic
1059958653 9:119544135-119544157 CTGAGATGTGGGGAGGGGAAGGG + Intergenic
1060814216 9:126626318-126626340 CTGTTTTATGGGGAGGGAGAAGG + Intronic
1061448496 9:130655753-130655775 CTGAGCTATGGAGAGGGGAAGGG + Intergenic
1061523555 9:131138241-131138263 CTAGGTTATGGGGAGGGGAGGGG - Intronic
1061584811 9:131558722-131558744 CTGTCTCCTGGGATGGGGAAGGG - Intergenic
1061696613 9:132380544-132380566 CAGCATTATGGGAAGGGAAAAGG - Intronic
1061741632 9:132710846-132710868 CTGTCAGAAGGGAAGGGGAAGGG - Intergenic
1186595951 X:10981456-10981478 TGGTGTTATGGGTAGGGGGAGGG + Intergenic
1186634354 X:11386455-11386477 CTGTCTTGTGGGAAGGGGAGAGG + Intronic
1187214903 X:17266676-17266698 TTGTGTCATGGGTTGGGGAAGGG + Intergenic
1187592999 X:20739551-20739573 CTGTCTTGTGGCAGGGGGAAGGG - Intergenic
1187744418 X:22392690-22392712 CTGTGCTGTGGCTAGGGGAAAGG + Intergenic
1188485599 X:30678460-30678482 CTAAGTTGTGGGATGGGGAATGG + Intronic
1188582482 X:31731401-31731423 CTGTGACATGGGAAGCTGAAAGG + Intronic
1189331223 X:40146089-40146111 GTGTGCTAGGGGAAGAGGAAGGG - Intronic
1189957899 X:46294899-46294921 CTGAGTAATGGTAAGTGGAACGG - Intergenic
1190947981 X:55114461-55114483 ATATGTAATGGCAAGGGGAAGGG + Intronic
1192233460 X:69281434-69281456 GTGTGTGGTGGGAAGGTGAAAGG - Intergenic
1192729989 X:73793484-73793506 CTGTGATATGGAAAGGGGAAGGG - Intergenic
1193054923 X:77139718-77139740 CTGTGGCATGGGGAGGAGAATGG - Intergenic
1194143225 X:90231162-90231184 CTCTGTTATGGGAATGAGAAAGG + Intergenic
1195493907 X:105507470-105507492 GTGTATGATGGGAGGGGGAAGGG - Intronic
1195627312 X:107017650-107017672 CTGTGTTGTGTTAAGGAGAAAGG + Intergenic
1195962599 X:110401572-110401594 CTGTGTTGTGGTAAGGGGAAGGG + Intronic
1196053092 X:111326151-111326173 ATGAGTTGGGGGAAGGGGAATGG + Intronic
1196276004 X:113766100-113766122 TTGTGTTAGGGTCAGGGGAAGGG + Intergenic
1197301179 X:124782672-124782694 ATGTGTTATGGGAGTGGCAATGG - Intronic
1198414812 X:136409326-136409348 ATCTGTTATGGGAAAGGAAAAGG + Intronic
1200488977 Y:3800484-3800506 CTCTGTTACGGGAATGAGAAAGG + Intergenic
1201428176 Y:13877112-13877134 CTGTGTCAAGGAAAGGGGGAAGG + Intergenic