ID: 1032010668

View in Genome Browser
Species Human (GRCh38)
Location 7:128345280-128345302
Sequence GGTGCCACTGCACCCCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032010668_1032010671 8 Left 1032010668 7:128345280-128345302 CCAACTTGGGGTGCAGTGGCACC No data
Right 1032010671 7:128345311-128345333 TCACTGCAGCCTTGATCTCCTGG 0: 411
1: 7716
2: 18143
3: 38460
4: 89419
1032010668_1032010672 9 Left 1032010668 7:128345280-128345302 CCAACTTGGGGTGCAGTGGCACC No data
Right 1032010672 7:128345312-128345334 CACTGCAGCCTTGATCTCCTGGG 0: 363
1: 7193
2: 19118
3: 39551
4: 80168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032010668 Original CRISPR GGTGCCACTGCACCCCAAGT TGG (reversed) Intergenic
No off target data available for this crispr