ID: 1032011229

View in Genome Browser
Species Human (GRCh38)
Location 7:128349438-128349460
Sequence CAGGAGCTGATGGGCAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032011218_1032011229 -2 Left 1032011218 7:128349417-128349439 CCAAGCCTCCCTTCCAGTCCCCA No data
Right 1032011229 7:128349438-128349460 CAGGAGCTGATGGGCAAAGTTGG No data
1032011221_1032011229 -10 Left 1032011221 7:128349425-128349447 CCCTTCCAGTCCCCAGGAGCTGA No data
Right 1032011229 7:128349438-128349460 CAGGAGCTGATGGGCAAAGTTGG No data
1032011216_1032011229 9 Left 1032011216 7:128349406-128349428 CCTCTTGGCTCCCAAGCCTCCCT No data
Right 1032011229 7:128349438-128349460 CAGGAGCTGATGGGCAAAGTTGG No data
1032011220_1032011229 -7 Left 1032011220 7:128349422-128349444 CCTCCCTTCCAGTCCCCAGGAGC No data
Right 1032011229 7:128349438-128349460 CAGGAGCTGATGGGCAAAGTTGG No data
1032011210_1032011229 30 Left 1032011210 7:128349385-128349407 CCTGGCTTCCCTGCCTGCTTCCC No data
Right 1032011229 7:128349438-128349460 CAGGAGCTGATGGGCAAAGTTGG No data
1032011212_1032011229 22 Left 1032011212 7:128349393-128349415 CCCTGCCTGCTTCCCTCTTGGCT No data
Right 1032011229 7:128349438-128349460 CAGGAGCTGATGGGCAAAGTTGG No data
1032011213_1032011229 21 Left 1032011213 7:128349394-128349416 CCTGCCTGCTTCCCTCTTGGCTC No data
Right 1032011229 7:128349438-128349460 CAGGAGCTGATGGGCAAAGTTGG No data
1032011215_1032011229 10 Left 1032011215 7:128349405-128349427 CCCTCTTGGCTCCCAAGCCTCCC No data
Right 1032011229 7:128349438-128349460 CAGGAGCTGATGGGCAAAGTTGG No data
1032011214_1032011229 17 Left 1032011214 7:128349398-128349420 CCTGCTTCCCTCTTGGCTCCCAA No data
Right 1032011229 7:128349438-128349460 CAGGAGCTGATGGGCAAAGTTGG No data
1032011217_1032011229 -1 Left 1032011217 7:128349416-128349438 CCCAAGCCTCCCTTCCAGTCCCC No data
Right 1032011229 7:128349438-128349460 CAGGAGCTGATGGGCAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032011229 Original CRISPR CAGGAGCTGATGGGCAAAGT TGG Intergenic
No off target data available for this crispr