ID: 1032011700

View in Genome Browser
Species Human (GRCh38)
Location 7:128351654-128351676
Sequence CTCGCGTGCCGCCGCGCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032011700_1032011707 18 Left 1032011700 7:128351654-128351676 CCAGCAGCGCGGCGGCACGCGAG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1032011707 7:128351695-128351717 AGAGGCCCAGCAGCGCCAACGGG 0: 1
1: 0
2: 2
3: 16
4: 200
1032011700_1032011704 0 Left 1032011700 7:128351654-128351676 CCAGCAGCGCGGCGGCACGCGAG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1032011704 7:128351677-128351699 GACTGCAGAGCGCCGGGTAGAGG 0: 1
1: 0
2: 2
3: 9
4: 87
1032011700_1032011706 17 Left 1032011700 7:128351654-128351676 CCAGCAGCGCGGCGGCACGCGAG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1032011706 7:128351694-128351716 TAGAGGCCCAGCAGCGCCAACGG 0: 1
1: 0
2: 3
3: 12
4: 209
1032011700_1032011702 -7 Left 1032011700 7:128351654-128351676 CCAGCAGCGCGGCGGCACGCGAG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1032011702 7:128351670-128351692 ACGCGAGGACTGCAGAGCGCCGG 0: 1
1: 0
2: 1
3: 1
4: 70
1032011700_1032011703 -6 Left 1032011700 7:128351654-128351676 CCAGCAGCGCGGCGGCACGCGAG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1032011703 7:128351671-128351693 CGCGAGGACTGCAGAGCGCCGGG 0: 1
1: 0
2: 1
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032011700 Original CRISPR CTCGCGTGCCGCCGCGCTGC TGG (reversed) Exonic
900113598 1:1019755-1019777 CTCGGGTGCAGCCGCACTTCCGG + Intergenic
900205853 1:1431598-1431620 CTTGGGTGCAGCCGAGCTGCAGG + Intergenic
906189257 1:43885431-43885453 CTCGCGTGCCGGGGTGCTGGCGG + Intronic
906522261 1:46474597-46474619 CTCGCTTGCTGCTGCGCTGAGGG + Intergenic
915165659 1:153946512-153946534 CCCGCGTGGCGCAGCGCGGCGGG - Exonic
1067111883 10:43407275-43407297 CTCGCGTCCCGCCACGCAGATGG + Intronic
1075521476 10:123146208-123146230 CCCGCGTGCTCCCGCGCTGTTGG - Intergenic
1083886626 11:65576323-65576345 CCCGCTTGCCCACGCGCTGCAGG - Exonic
1092219155 12:6700897-6700919 CCCTCCTGCTGCCGCGCTGCAGG + Intergenic
1103520768 12:121536098-121536120 CACTCGTGCCGGCGCGCTGCTGG - Intronic
1105767976 13:23579547-23579569 CTCGCGGGACGCCGCGCGCCGGG - Intronic
1107778997 13:43879170-43879192 GTCGCGTGAGGCCGGGCTGCTGG - Intronic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1129853713 15:78810391-78810413 CTGCCGGGCGGCCGCGCTGCTGG - Intronic
1132585841 16:705483-705505 TGCGCGTGCGGCCGGGCTGCGGG - Intronic
1138434511 16:56989626-56989648 CGGGCGTGCCGCGGGGCTGCGGG + Intronic
1141741831 16:85898812-85898834 CTCGGGAGCCGCCGCACTCCCGG + Exonic
1141741926 16:85899163-85899185 CACGCTTGCTGCCGCGCTCCAGG - Exonic
1143541929 17:7573987-7574009 CAGGCGTGCCGCCGCGCTCACGG - Intronic
1145243578 17:21253234-21253256 CTCGGCTGCCGCCGTGCCGCTGG - Exonic
1148608010 17:48944747-48944769 CCCGCGGGCCGCCCGGCTGCCGG + Exonic
1149577333 17:57723661-57723683 CAGGCGTGCCGCAGAGCTGCAGG + Intergenic
1158436028 18:57435921-57435943 CACGCGGGCCGCGGCGCCGCTGG + Exonic
1161048834 19:2151412-2151434 CCCGCGGAGCGCCGCGCTGCCGG + Exonic
1165433737 19:35786001-35786023 CTCACAGCCCGCCGCGCTGCTGG + Intronic
1166121620 19:40690457-40690479 CACGCTGGCCGCCGCGCTGCGGG + Exonic
925224037 2:2167125-2167147 CTTGCCAGCCGCTGCGCTGCAGG + Intronic
932827977 2:74958898-74958920 CCCGCATGCCCTCGCGCTGCAGG - Intronic
935971505 2:108534410-108534432 CTCCCGCGCCCCCGCGCGGCCGG + Intronic
936126305 2:109791554-109791576 CTCCCCTGCCACCTCGCTGCAGG + Intergenic
936218388 2:110579914-110579936 CTCCCCTGCCACCTCGCTGCAGG - Intergenic
942454739 2:176130064-176130086 CCCGCGCGCCGCCGCCCTCCCGG - Exonic
946340186 2:219061269-219061291 CTCGCGTCCGGCCGCGCCGTGGG - Intergenic
947585945 2:231357056-231357078 CTCAAGTGCCTCCGCCCTGCAGG - Intronic
947860560 2:233354680-233354702 CGCCCGGGCCGCCGCGCCGCGGG - Intronic
1169164084 20:3407613-3407635 CTAGCGTGGAGCCGCCCTGCGGG - Exonic
1174680353 20:52400449-52400471 CTCCAGTGCCGTGGCGCTGCAGG + Intergenic
1176429017 21:6564796-6564818 CTGGCGTCCCGCCCCGGTGCCGG - Intergenic
1178544281 21:33480041-33480063 CTCGCGTCCCGCCCCGCCCCCGG - Intergenic
1179704506 21:43173112-43173134 CTGGCGTCCCGCCCCGGTGCCGG - Intergenic
1180090585 21:45531851-45531873 CTCGCGCGCTGCGGTGCTGCTGG - Exonic
1182550545 22:31098702-31098724 CTCGAGCGCCGCCAGGCTGCCGG - Exonic
1184098884 22:42331164-42331186 GTCGCGCTCCGCGGCGCTGCCGG - Intronic
950590476 3:13933063-13933085 CGCGCGTGCCTCGGCGCCGCCGG - Intergenic
950902893 3:16513321-16513343 CGCGCGTGGCGCCTCCCTGCAGG - Intronic
953561223 3:43995283-43995305 CTCGACCGCCGCGGCGCTGCAGG - Intergenic
960801945 3:121548758-121548780 CGGGCGTGGCGCCGGGCTGCTGG - Intergenic
969429854 4:7147763-7147785 CTCCCGTCCCGCAGAGCTGCAGG - Intergenic
982224484 4:153153369-153153391 CGCGCGTGCGGCGGGGCTGCGGG + Intronic
998083305 5:139294173-139294195 CACGCGGGCCGCGGCGCTGAGGG + Intronic
1002929560 6:1624097-1624119 CTCCGGTGCAGACGCGCTGCGGG - Exonic
1025089725 7:56052020-56052042 ACCGCGCGCCGCCGCGCTCCTGG + Intronic
1032011700 7:128351654-128351676 CTCGCGTGCCGCCGCGCTGCTGG - Exonic
1049651602 8:143772257-143772279 GCCGCGGGCCGCCGCGCTGAGGG + Intergenic
1052991902 9:34523327-34523349 CTCTCGTGCCGGCGCGGGGCGGG + Intergenic
1053435244 9:38069503-38069525 CTGGGGTCCCGCCGCGCAGCCGG + Intergenic
1185465520 X:352290-352312 TGGGCGTGCCGCCGCGTTGCCGG - Intronic
1198727319 X:139691640-139691662 CTGGCCAGCTGCCGCGCTGCAGG - Intronic
1202599785 Y:26581517-26581539 CTGGTGAGCCGCCTCGCTGCAGG + Intergenic