ID: 1032011700

View in Genome Browser
Species Human (GRCh38)
Location 7:128351654-128351676
Sequence CTCGCGTGCCGCCGCGCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032011700_1032011703 -6 Left 1032011700 7:128351654-128351676 CCAGCAGCGCGGCGGCACGCGAG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1032011703 7:128351671-128351693 CGCGAGGACTGCAGAGCGCCGGG 0: 1
1: 0
2: 1
3: 6
4: 114
1032011700_1032011706 17 Left 1032011700 7:128351654-128351676 CCAGCAGCGCGGCGGCACGCGAG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1032011706 7:128351694-128351716 TAGAGGCCCAGCAGCGCCAACGG 0: 1
1: 0
2: 3
3: 12
4: 209
1032011700_1032011704 0 Left 1032011700 7:128351654-128351676 CCAGCAGCGCGGCGGCACGCGAG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1032011704 7:128351677-128351699 GACTGCAGAGCGCCGGGTAGAGG 0: 1
1: 0
2: 2
3: 9
4: 87
1032011700_1032011707 18 Left 1032011700 7:128351654-128351676 CCAGCAGCGCGGCGGCACGCGAG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1032011707 7:128351695-128351717 AGAGGCCCAGCAGCGCCAACGGG 0: 1
1: 0
2: 2
3: 16
4: 200
1032011700_1032011702 -7 Left 1032011700 7:128351654-128351676 CCAGCAGCGCGGCGGCACGCGAG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1032011702 7:128351670-128351692 ACGCGAGGACTGCAGAGCGCCGG 0: 1
1: 0
2: 1
3: 1
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032011700 Original CRISPR CTCGCGTGCCGCCGCGCTGC TGG (reversed) Exonic