ID: 1032013411

View in Genome Browser
Species Human (GRCh38)
Location 7:128360970-128360992
Sequence GTGTGCGCGCGCGCGTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 2, 2: 16, 3: 65, 4: 295}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032013411_1032013418 24 Left 1032013411 7:128360970-128360992 CCCCTGCACGCGCGCGCGCACAC 0: 1
1: 2
2: 16
3: 65
4: 295
Right 1032013418 7:128361017-128361039 AGCCACTCTCCTCCCTGCATGGG 0: 1
1: 1
2: 1
3: 26
4: 277
1032013411_1032013417 23 Left 1032013411 7:128360970-128360992 CCCCTGCACGCGCGCGCGCACAC 0: 1
1: 2
2: 16
3: 65
4: 295
Right 1032013417 7:128361016-128361038 GAGCCACTCTCCTCCCTGCATGG 0: 1
1: 0
2: 3
3: 23
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032013411 Original CRISPR GTGTGCGCGCGCGCGTGCAG GGG (reversed) Intronic
900215483 1:1479407-1479429 GTGTGGGCCCGTGTGTGCAGGGG - Intronic
900222743 1:1518080-1518102 GTGTGGGCCCGTGTGTGCAGGGG - Intronic
901361388 1:8703506-8703528 GTGTGTGCGCGCGCCCGCGGCGG - Intronic
901660147 1:10794197-10794219 GTGCGCGCGCGCGCGCGTCGTGG + Intronic
901686304 1:10945504-10945526 GTGTGAGCGGGAGAGTGCAGCGG - Intergenic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
902044331 1:13513721-13513743 GCGTGCGCCCGGGCGTGCGGGGG + Exonic
902538350 1:17134889-17134911 GTGTGCGCGTGCGCATGCGGGGG - Intergenic
903324695 1:22563329-22563351 GTGGGCGTGCGCACGTGCGGCGG + Intergenic
904837733 1:33349842-33349864 GGTTGCGCGCGCGCGCGCGGCGG + Intronic
905037687 1:34928710-34928732 GCGTGTGCGCGCGCGTGCGTTGG - Intronic
905231835 1:36519251-36519273 GCGCGCGCGCTCACGTGCAGGGG + Intergenic
906077635 1:43063688-43063710 GTGTGTGTGCGCGCATGTAGGGG + Intergenic
907526478 1:55056865-55056887 GCGTGCGCGCGCGCGCGTTGGGG + Intronic
910063445 1:83122096-83122118 GTGCGCGCATGCGTGTGCAGTGG + Intergenic
912684243 1:111749444-111749466 GTGCGCGCGCGCGCGTGCTAGGG + Intronic
913319408 1:117577907-117577929 GTGTGCGCGCGCGCGCAATGAGG + Intergenic
914869118 1:151458807-151458829 GAGTGCGCGCGCGCGCGCCGCGG + Intronic
917565382 1:176207269-176207291 GTGCGCGCGCGCGCGAGCGGCGG + Exonic
918995793 1:191757538-191757560 GTGTGTGCGCGCGCGTGGGTGGG - Intergenic
919930009 1:202215015-202215037 GTGTGTGCGCGCGCGCGCGTTGG + Intronic
920524997 1:206659793-206659815 GTGTGTGCGCGCGCACGCACCGG - Intronic
921217730 1:212951450-212951472 GTGTGCGCGCGGGCGCGGCGAGG - Exonic
921708023 1:218346039-218346061 GTGTGCGTGTGCGCGCGCTGGGG - Intergenic
922250510 1:223845595-223845617 GTGTGCGGGGTCGCGTGCCGGGG - Intronic
922419826 1:225452068-225452090 GTGGGCGCGGGCGTGGGCAGCGG - Intergenic
922577049 1:226667852-226667874 GTGCGCGCGCGCGTGCGAAGTGG + Intronic
922648720 1:227318511-227318533 GTGTGCGCGCGCGTGTGCCGGGG - Intergenic
923463380 1:234226934-234226956 GTGCGCGCACGCCAGTGCAGGGG - Intronic
923783230 1:237043297-237043319 GTGTGCGCGCGCGCGGGTGGTGG + Intronic
924799340 1:247316229-247316251 GTGTGTGTGAGCGCGCGCAGTGG + Intronic
1062794894 10:337344-337366 GTGTGCGCGCGTGTGTGTTGTGG + Intronic
1063382103 10:5591895-5591917 GTGTGCGCGTGCACGTGCAGAGG - Intergenic
1063624806 10:7679009-7679031 GTGTGTGCGCGCGCGCGCGGAGG - Intergenic
1066467848 10:35669180-35669202 GTGTGCGTGCGTGTGTGTAGGGG + Intergenic
1067560210 10:47300154-47300176 GTGTGCGCCCGCGAGTGTGGGGG - Intergenic
1067650712 10:48152943-48152965 GTGTGCGCGCGCGTGTGGGAAGG - Intergenic
1068301211 10:55143070-55143092 GAGAGCGCGAGCGCGAGCAGGGG - Intronic
1068519797 10:58065621-58065643 GTGTGTGCGCGCGCGTGTTTAGG + Intergenic
1068953863 10:62804839-62804861 GCGTGCGCGTGCGCGCTCAGAGG + Exonic
1069653691 10:70071087-70071109 GTGTGTGTGCGCGTGTGCACAGG + Intronic
1069976286 10:72215993-72216015 GCGTGCGCGCGCCCGTGCCGTGG - Exonic
1070610657 10:77930104-77930126 GTGTGAGTGCGTGTGTGCAGGGG - Intergenic
1071997567 10:91163008-91163030 GCGAGCGCGCGCGCGTGGGGCGG - Intronic
1072492961 10:95926868-95926890 GTGTGTGCGCGCGCCTGAACAGG + Intronic
1072881252 10:99232194-99232216 GTATGCGCGCGCGCGCGTTGGGG - Intronic
1073326219 10:102645196-102645218 GTGTGTGCGCGCGCGCGCGTAGG - Intronic
1073392586 10:103192263-103192285 GTGTGTGCGCGCCCGTCCAGGGG - Intronic
1073463755 10:103681757-103681779 GTGTGTGCGCGCGCGCGCGCGGG - Intronic
1074088479 10:110226416-110226438 GTGTGCGCGCGTGAGGGTAGAGG + Intronic
1076568821 10:131417916-131417938 GTGTGTGTGTGCGCGTGCACAGG - Intergenic
1078188731 11:9074408-9074430 GTGTGTGTGTGCGCGTGCAAGGG + Intronic
1079291132 11:19188654-19188676 GTGGGCGCGCGCGTTGGCAGGGG + Intronic
1079798163 11:24833699-24833721 GTGTGTGTGCGCGCGCGCGGTGG - Intronic
1079910198 11:26300187-26300209 GTGTGCGTGCGTGCTTGCATGGG - Intergenic
1081528275 11:43942074-43942096 GTGCGCGCGCGCGCCTGCGGAGG + Intronic
1081804140 11:45881027-45881049 GTGTGTGTGCGCGTGTGCAGAGG + Exonic
1082035554 11:47642567-47642589 GCGTGCGTGCGCGCGCGCCGCGG - Exonic
1084265729 11:68004201-68004223 GCGCGCGCGCGTGTGTGCAGGGG + Intronic
1088566747 11:111180604-111180626 GTGTGCGCGCACGCGTGTGGTGG - Intergenic
1089500028 11:118926242-118926264 GTGTGCGCGCGCGTGTGTCCAGG - Intronic
1092046916 12:5437875-5437897 ATGTGCGTGCGTGCGTGCTGGGG + Intronic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1093547839 12:20369205-20369227 GTGTGTGCGCGCGCGCGCGTGGG + Intergenic
1093547840 12:20369209-20369231 GTGCGCGCGCGCGCGTGGGTCGG + Intergenic
1094465926 12:30754418-30754440 GGGTGCGCGCTGGCGTGCATGGG - Exonic
1096242677 12:49967674-49967696 GTGTGTGCGCGCGTGTGCACGGG - Intronic
1096481107 12:51941569-51941591 GTGTGTGCGCGCGCGCGCGTGGG - Intergenic
1096847903 12:54418206-54418228 GGGTGTGTGCGCGCGTGAAGGGG - Intronic
1097232436 12:57520836-57520858 GTCTGCACGCGCACGCGCAGGGG + Intronic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1098636252 12:72787434-72787456 GTGTGTGTGCACGTGTGCAGAGG + Intergenic
1098919180 12:76287244-76287266 GTGTGTGCGTGTGTGTGCAGAGG + Intergenic
1099924433 12:89000248-89000270 GTGTGCCCGCGTGTGTGCACTGG + Intergenic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1100150453 12:91730360-91730382 GTGTGCGCGCACGTGTGCATGGG + Intergenic
1101354718 12:103966121-103966143 GCGCGCGCGCGCGCACGCAGGGG + Intronic
1101640575 12:106583586-106583608 GTGTGCGTGCGCGCGCGCGAAGG + Intronic
1101966389 12:109285168-109285190 GTGTGCGCGTGCGTATGCATCGG + Intronic
1103940983 12:124501035-124501057 GTGCGCGCGCGCTCGTGCCGTGG - Intronic
1104916545 12:132268264-132268286 GTGTGTGCGTGCGTGTGTAGGGG - Intronic
1106027688 13:25971026-25971048 GTGTGCGCGCACACATGCACGGG + Intronic
1107359464 13:39603142-39603164 GTGGGCGCGCGCGGGCGCCGGGG + Exonic
1107459236 13:40585330-40585352 GTGTGTGTGCGCGCGCGCAGAGG - Intronic
1108363705 13:49690485-49690507 GTGTGCGTGCGCGTGTGTGGTGG + Intronic
1110779448 13:79447880-79447902 GTGTGCCTGTGCGCTTGCAGAGG - Intergenic
1110922491 13:81106116-81106138 GTGTGCGCGCGTGCGCGCACAGG - Intergenic
1112508764 13:99990827-99990849 GTGTGTGTGCGCGCGCGCAAAGG - Intergenic
1112509429 13:99997064-99997086 GTGTGCGCGCGCGCGCCCCTGGG + Intergenic
1113653938 13:112056727-112056749 GTGTGCGCGCGCGCGAGGCGAGG + Intergenic
1113667518 13:112151088-112151110 GTGTGTGTGCGCGCTTGCCGTGG - Intergenic
1114612752 14:24053045-24053067 GTGTGCACGCGCGTGTGCTGGGG - Intronic
1118323157 14:64765036-64765058 GTGTGTGCGCGCGCGCGCGCGGG + Intronic
1118442601 14:65825893-65825915 GTGTGCCCGTGCGTGTGCACGGG - Intergenic
1119808642 14:77498824-77498846 GGGTTCGCGGCCGCGTGCAGAGG - Exonic
1120834582 14:89028021-89028043 GTGTGCGCGCGCGCGCGGACAGG - Intergenic
1120850014 14:89161589-89161611 GTGTGTGTGCGTGCGTGCACAGG + Exonic
1122183425 14:99971766-99971788 GTGTGCGCGGGCGCGTGCCTGGG - Intronic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1122418330 14:101560826-101560848 GTGTGAGCGCGCGCGGGAGGCGG + Intergenic
1122630449 14:103105148-103105170 GGGAGTGCGCGCGCGTGGAGGGG + Intronic
1122993334 14:105249105-105249127 GTGGGCGCGCGCGGGCGCGGGGG - Intronic
1123007874 14:105333146-105333168 GTGTGTGCACACGCGTGCATGGG - Intronic
1124629460 15:31328225-31328247 CTGAGCGCGCGCCCGGGCAGCGG - Intronic
1125248946 15:37677166-37677188 CTGTGCGGGTGCGCATGCAGAGG + Intergenic
1126393923 15:48191615-48191637 GTGTGCGCGCGCGCGTTTGCAGG - Exonic
1126725043 15:51622985-51623007 GTTTGCGCGTGCGCGCGCCGTGG + Intergenic
1127674633 15:61228268-61228290 GTGTGCGCGCCAACGCGCAGAGG - Intronic
1128454216 15:67823532-67823554 CTGTGCGCGCGCGCGGGGAGGGG + Intronic
1128791138 15:70434707-70434729 GCGCGCGCGCGCGGGTGGAGCGG - Intergenic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1129570872 15:76682438-76682460 GTTTGCACTCGCGCTTGCAGTGG - Intronic
1129741243 15:77990656-77990678 GTGTGTGCGCGCGCATGTTGGGG - Intronic
1132583019 16:694038-694060 GTGTGCGTGCGTGCGTGGGGCGG + Exonic
1132692183 16:1186561-1186583 GTGTGTGGGCACGTGTGCAGAGG - Intronic
1133020201 16:2963807-2963829 GTGCGAGCGCGTGCGTGCACTGG + Intergenic
1133340666 16:5033677-5033699 GCGCGCGCGCGCGCGTGGATAGG + Exonic
1133924259 16:10181170-10181192 GTGTGCACGCGCGCGTGTAGGGG - Intronic
1135037738 16:19092171-19092193 GTGTGTGTGCGCGCGCGCATTGG + Intergenic
1135656685 16:24256282-24256304 GTGTGCGAGCGCGTGTGCTGGGG - Exonic
1136399876 16:30011447-30011469 GTGGCCGCGCGCGCGGGCGGGGG - Intronic
1137365478 16:47855895-47855917 GTGTGTGTGCGCGTGTTCAGAGG + Intergenic
1138911973 16:61411891-61411913 GTGTGCGTGCTCATGTGCAGTGG - Intergenic
1141647277 16:85374540-85374562 GTGTGCGCGCGCGCGTGCACAGG + Intergenic
1142812102 17:2400249-2400271 GTGTGCGTGCGTGTGTGCACGGG - Intronic
1143102603 17:4512638-4512660 GTGTGTGCGTGCGCGCGCACGGG + Intronic
1143321360 17:6070846-6070868 GAGTGAGCGGGTGCGTGCAGGGG + Intronic
1144172835 17:12676230-12676252 GTGTGTGCGTGCGCGCGCAGGGG - Intronic
1144757148 17:17686603-17686625 GTGTGTGCACGCGCGCGCCGGGG + Intronic
1147864956 17:43545977-43545999 GTGTACGCGCGCGCGCGCGGAGG + Intronic
1148452693 17:47790230-47790252 CTCGGCGCGCTCGCGTGCAGCGG - Intergenic
1148652700 17:49261016-49261038 GTGTGCGCGCGCGCCAAGAGTGG + Intergenic
1149038518 17:52159594-52159616 GTGTGCGCGCGCGGGTTTGGTGG - Intronic
1149347738 17:55754835-55754857 GTGTGCGCGCGTGTGTGTATTGG + Intronic
1151490925 17:74432025-74432047 GTGCGCGCGCCCGCATGCGGGGG + Exonic
1151509830 17:74551437-74551459 GTGTGTGCGCACGCATGCACAGG - Intergenic
1152038470 17:77888065-77888087 GTGTGCGCGCACCCGTGCATGGG - Intergenic
1152148683 17:78585156-78585178 GTGTGTGTGTGCGCGTGCATAGG - Intergenic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152245726 17:79183717-79183739 GCGTGTGCGCGCGTGTGTAGCGG + Intronic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1152466691 17:80470679-80470701 GTGTGCGTGTGCGTGTGCAGGGG + Exonic
1152575499 17:81138952-81138974 GGGTGCGCGCGCACGTGTGGGGG - Intronic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1154954287 18:21240562-21240584 GTGTGTGCGCGCGCGCGCGCGGG - Intergenic
1156099776 18:33578854-33578876 GTGTGTGCGTGCGCGCGCGGAGG + Intronic
1156099778 18:33578856-33578878 GTGTGCGTGCGCGCGCGGAGGGG + Intronic
1157032974 18:43935846-43935868 GTGTGTGTGTGTGCGTGCAGTGG + Intergenic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1158427474 18:57352713-57352735 GTGAGCGCGCGCGCGTGTGGCGG - Exonic
1159963649 18:74575739-74575761 GTGTGTGCGCGTGTGTGAAGGGG + Intronic
1160357892 18:78244193-78244215 GTGTGTGCGCGTGTGTGAAGTGG - Intergenic
1160429132 18:78799603-78799625 GTGCGCGCGCGCGTGTGCAGTGG - Intergenic
1160452401 18:78974324-78974346 GCGTGCGCGTGCGCGTGCGAAGG - Intergenic
1160968055 19:1755203-1755225 GTGTGAGCGCGCGCCTGTTGGGG + Intronic
1160992953 19:1867958-1867980 GTGTGCGTGCGCGCATGCACTGG + Intergenic
1161264778 19:3359276-3359298 GTGTGTGTGCGCGCGCGCCGCGG + Intergenic
1161643068 19:5436358-5436380 GTGTGCGCGCGCGCGCGTGCGGG + Intergenic
1161725470 19:5925871-5925893 GTGTGCGCGTGCATGTGCTGGGG + Intronic
1162129534 19:8517566-8517588 GTGTGTGTGCGTGTGTGCAGGGG + Intergenic
1162584514 19:11550920-11550942 GTGTGCACGCGCGCGCGCATTGG - Intergenic
1163390764 19:17028423-17028445 GTGTGCGTGCACGCGCGCAGGGG + Intergenic
1163649607 19:18509572-18509594 GCGCGCGCGCGCACGTGCATTGG - Intronic
1163804126 19:19385918-19385940 GGGTGCGCGTGCGCGCGCCGGGG - Exonic
1166780787 19:45341575-45341597 GTGTGCGCGCGCGCGTGTGGTGG + Intronic
1167156812 19:47743607-47743629 GTGTGCGCGCGCTCACGCACCGG + Intergenic
1168336526 19:55600356-55600378 GTGCGCGCGCGCGGGGGCAACGG - Intronic
925532254 2:4877115-4877137 GTGTGTGCGCGCGCGCGCCTGGG - Intergenic
925717721 2:6799916-6799938 GTGTGCACGTGCCTGTGCAGAGG + Intergenic
925801629 2:7607768-7607790 GTGTGTGTGCACGCGTGCACAGG + Intergenic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
931516576 2:63053730-63053752 GTGTGCGTGTGTGTGTGCAGGGG + Intronic
932625674 2:73293758-73293780 GGGAGCGCGCGCGCACGCAGCGG - Intergenic
932790194 2:74648313-74648335 GCGTGCGCCCGCGCGTTCGGAGG + Intronic
935408573 2:102735829-102735851 GTGTGCGCGCGCGCGTGTCCTGG - Intronic
937950854 2:127387381-127387403 GTGTGCGCGCGTGTGTGTCGGGG - Intronic
938461892 2:131502709-131502731 GTGTGCGCGTGCGCGTGCAATGG - Intergenic
938900482 2:135795030-135795052 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
940902203 2:159136048-159136070 GTGCGCGCGCGCGCGTTTAAGGG + Intronic
941095505 2:161237015-161237037 GTGTGCGCGCGCGCGGAGAAGGG - Intergenic
941580810 2:167293578-167293600 GTGTGCGCGCGCGCGGCTTGGGG + Intergenic
942454849 2:176130559-176130581 GGGTGCGCGTGCGCCTGCGGGGG - Exonic
944494906 2:200296895-200296917 GTGCGTGCGCGCGCATTCAGGGG - Intergenic
945033357 2:205684937-205684959 GTGTGCGCGCTCGCGCGCTGGGG - Intronic
945699440 2:213151853-213151875 GTGTGCGCGCGCGCGCGGGCTGG + Intronic
946747626 2:222861395-222861417 GTGTGCGCGCGGGCGGCCCGCGG + Intronic
948640453 2:239372479-239372501 GTGTGCGCGCGTGTGTGCGCGGG - Intronic
948661564 2:239510096-239510118 GTGTGTGTGCGTGTGTGCAGTGG + Intergenic
1171963725 20:31514400-31514422 GTGTGCGCGCGTGCGCGGCGCGG + Intergenic
1172840875 20:37902245-37902267 GTGTGCGCGCGCGTATGCGTGGG - Intergenic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1174467856 20:50731392-50731414 GTGAGCGCGCGCACGCGCCGCGG + Intergenic
1174804764 20:53594713-53594735 GTGTGCGCGGGCGAGGGGAGGGG + Intronic
1175479431 20:59300886-59300908 GTGTGCGCTCGCGCCAGGAGAGG - Intronic
1175841312 20:62029469-62029491 GTGTGCGCGCGCGCGCACGTGGG - Intronic
1175911502 20:62407312-62407334 GCGCGCGGGCGCGCGGGCAGGGG - Intergenic
1176194571 20:63831295-63831317 GGGCGCGCGCGCGCGGGCGGCGG - Intergenic
1176414379 21:6466648-6466670 GTGCTGGCGCGCGAGTGCAGGGG - Intergenic
1176550496 21:8218949-8218971 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176577338 21:8446219-8446241 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1177860830 21:26451862-26451884 GTGTGTGTGTGTGCGTGCAGTGG - Intergenic
1179133573 21:38660592-38660614 GTGTGCCAGCGCGCGTGCCTTGG + Intronic
1179689877 21:43074970-43074992 GTGCTGGCGCGCGAGTGCAGGGG - Intronic
1180246072 21:46548210-46548232 TTGTGTGCGCCTGCGTGCAGGGG + Intronic
1181069257 22:20322341-20322363 GTGTGTGCGCGCGCGCACAATGG - Intergenic
1181401507 22:22652835-22652857 GTGTGTGCGCGCACGTGCACTGG + Intergenic
1182041635 22:27242811-27242833 GTGTGTGCGCGCGTGCGCGGGGG - Intergenic
1182041637 22:27242813-27242835 GTGTGTGTGCGCGCGTGCGCGGG - Intergenic
1182149510 22:28018293-28018315 GTGTGTGCGCGCGCGGGGGGGGG + Intronic
1182149512 22:28018295-28018317 GTGTGCGCGCGCGGGGGGGGGGG + Intronic
1183664998 22:39242096-39242118 GTGTGCGCGCACGTGTGCTCAGG + Intronic
1184128940 22:42505719-42505741 GTGTGCGCGTGCGTGTGGTGGGG - Intergenic
1184128942 22:42505721-42505743 GTGTGTGCGCGTGCGTGTGGTGG - Intergenic
1184137735 22:42559034-42559056 GTGTGCGCGTGCGTGTGGTGGGG - Intronic
1184137737 22:42559036-42559058 GTGTGTGCGCGTGCGTGTGGTGG - Intronic
1184724583 22:46336079-46336101 GTGGGCGCGCGTGGGTGGAGAGG - Intronic
1184779457 22:46639602-46639624 GTGTGCATGCCCGTGTGCAGTGG + Intronic
1185093780 22:48794161-48794183 GTGTGCGTGTGCGCGTGCGTGGG + Intronic
1185100402 22:48837638-48837660 GTGTGCGCACGTGTGTGCATGGG - Intronic
1203255393 22_KI270733v1_random:135290-135312 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
951110000 3:18792006-18792028 GTGTGCGCGCGCACGCACACAGG - Intergenic
951640599 3:24830439-24830461 GTGTACGTGCGCGCGCGCCGTGG + Intergenic
952316865 3:32238982-32239004 GTGTGCGAGCGGGCGCGCTGCGG - Exonic
952971077 3:38650530-38650552 GTTTGCGCGCGCGCGTGTGTGGG - Intergenic
953631993 3:44625733-44625755 GTGTGCGCGCGCGCGCGCAAAGG - Intronic
954256661 3:49412060-49412082 GTGAGTGCGCGCGCGTGCGCGGG - Exonic
956129180 3:66038452-66038474 GAGTGCGCGAGCGTGTGCAGGGG - Intronic
957792910 3:84961632-84961654 GTGTGTGCGCGCGCGCGCGCCGG + Intronic
960465936 3:117996887-117996909 GTGCGCGCGCGCGTGTGAACGGG - Intergenic
961335937 3:126179886-126179908 GTGGACGGTCGCGCGTGCAGAGG - Intronic
962263113 3:133927527-133927549 GCGTGCGTGCGTGCGTGCGGTGG + Intergenic
962575620 3:136752493-136752515 GTTTGCGCGCGCCCCTGCCGCGG - Intergenic
963228743 3:142888925-142888947 GTGTGCCGGCGCGCGCGCCGTGG - Exonic
963335713 3:143971974-143971996 GTGCGCGTGCGCGCGGGCACGGG + Exonic
963722085 3:148873352-148873374 GTGTGCGCGCGTGCATGCACTGG - Intronic
963922699 3:150921388-150921410 GTGTGTGCGTGCACATGCAGGGG - Intronic
964430471 3:156600518-156600540 GCGCGCGCGCGCGCATGCACTGG + Intergenic
965824423 3:172716576-172716598 GTGTCCGCGCCCGCGTGATGGGG + Intergenic
966593003 3:181702016-181702038 GTGCGCGCGCGCGCATGGGGGGG - Intergenic
966593005 3:181702018-181702040 GTGTGCGCGCGCGCGCATGGGGG - Intergenic
966593007 3:181702020-181702042 GTGTGTGCGCGCGCGCGCATGGG - Intergenic
966818556 3:183908080-183908102 GTGTGCGCGTGCGTGGGGAGAGG + Intergenic
967173868 3:186845150-186845172 GTGTGGGTGTGCGCGTGCATAGG + Intronic
968063761 3:195746902-195746924 GTGTGCACGCGCGCGTGCACAGG + Exonic
968108786 3:196025126-196025148 GTGTGCGCTCATGCGTGCATGGG - Intergenic
968434455 4:577143-577165 GTGTGCGCGCGCGTGTGTGCGGG + Intergenic
968584072 4:1407844-1407866 GAGCGCGCGGGCGCGTGCACCGG + Intergenic
970826545 4:20283105-20283127 GTGTGTGCGCGCGCGCACACAGG - Intronic
975016745 4:69430864-69430886 GTGCGGGCGTGCGAGTGCAGTGG - Intergenic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
977845233 4:101759878-101759900 GTGTGCACACGCACATGCAGGGG + Intronic
979469020 4:121072675-121072697 GCGTGCGCGCTGGCGCGCAGCGG - Intronic
979475609 4:121154022-121154044 GTGTGCGTGTGTGCATGCAGGGG - Intronic
981034458 4:140154504-140154526 GTATGCGCGCGCGCGTGCGCGGG + Intergenic
981597685 4:146445917-146445939 ACGTGCGCACGCGCGTGCACGGG + Intronic
983577002 4:169270994-169271016 GTGTGTGTGCGCGCGTGAGGGGG - Exonic
983672166 4:170250617-170250639 GTGTGTGCGCGTGCGAGCTGTGG + Intergenic
984024116 4:174522520-174522542 CTGCACGCGCGCGCGCGCAGGGG - Exonic
985383837 4:189424459-189424481 GTGTGCGCGTATGCGTACAGGGG - Intergenic
985537425 5:473104-473126 GAGTGCGCACGCGCGTTCGGCGG - Intergenic
985895918 5:2750077-2750099 CTGTGTGCGCGCACGTGCAAGGG - Intronic
985963944 5:3325250-3325272 GTGTGAGCGCGCGCGTGCGTGGG + Intergenic
986163312 5:5250733-5250755 GTGTGCGCGCACTCCTGGAGAGG + Intronic
986976028 5:13395018-13395040 GTGTGCACGCGCGCGCGCACTGG - Intergenic
986976034 5:13395105-13395127 GTGTGCGCGCGCGCGTGCACTGG - Intergenic
987175437 5:15303434-15303456 GTGCGCGCGTGCGTGTGCTGAGG + Intergenic
987901086 5:24013048-24013070 GTGCGCGCGCGCGCAGGCTGTGG + Intronic
989033991 5:37150507-37150529 GTGTGCGCGCGTGTGTGTTGGGG - Intronic
993919148 5:93779127-93779149 GCGCGCGCGCGCACGTGCAGGGG + Intronic
995250157 5:109983944-109983966 GTGTGTGCGCACGCGCACAGTGG - Intergenic
997237158 5:132279342-132279364 GTGCGCGCGCGCGCGCGCGTGGG - Intronic
997459874 5:134044655-134044677 GTGTGTGTGCGCGCGCGCACAGG + Intergenic
997899844 5:137754365-137754387 GAGGGTGCGCGCGCGTTCAGCGG - Exonic
998029503 5:138852852-138852874 GTGCGCGCGCGCGCGAAAAGAGG - Intronic
998143248 5:139711409-139711431 GTGTGTGCGCGCGCGCTCCGAGG + Intergenic
998143250 5:139711411-139711433 GTGTGCGCGCGCGCTCCGAGGGG + Intergenic
999243657 5:150141766-150141788 GTGTACACGCGCACGTGCTGAGG + Intronic
1000463315 5:161547823-161547845 GTGCGCGCGGGTGCGCGCAGCGG - Intronic
1000517809 5:162261177-162261199 GTGTGCACCCGCGCGTGCACGGG - Intergenic
1000665421 5:163989213-163989235 GTGTGTGCGCGCGCGTGTGGGGG + Intergenic
1000665423 5:163989215-163989237 GTGTGCGCGCGCGTGTGGGGGGG + Intergenic
1001245729 5:170104852-170104874 GTGTGTGCGCGTGCGTGCGTGGG + Intergenic
1002058834 5:176614168-176614190 GTGTGTGTGCGCGCGCGCAGGGG - Intergenic
1002193799 5:177491775-177491797 GCGTGGGCGCGGGCGGGCAGGGG + Intronic
1002193997 5:177492483-177492505 GGGTGCGCCCGCGCTGGCAGTGG - Intronic
1002199066 5:177516871-177516893 GTGTGGGAGCGGGCGTGAAGAGG - Intronic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1002521758 5:179796260-179796282 GCGCGCGCGCTCGCGTACAGCGG - Exonic
1002559739 5:180072914-180072936 GTGTGCGCGCGCGCGCGTTTCGG - Intergenic
1003035487 6:2637533-2637555 GTGTGTGTGTGCGCGTGCGGGGG + Intergenic
1004849214 6:19679527-19679549 GTGTGTGCGCGCGCATGTGGTGG + Intergenic
1006271989 6:32972084-32972106 GCGAGCGCGCGCGCGCGGAGGGG + Exonic
1006337532 6:33428204-33428226 GTGTGCGTGGGCGCGGGGAGGGG + Intronic
1006458322 6:34144347-34144369 GTGTACGCGCGTGTGTGCTGGGG - Intronic
1007600576 6:43078257-43078279 GTGTGCGCGCGTGTGTGTGGGGG + Intronic
1012872897 6:104693053-104693075 GTGTGCACGCGCGCGCGCGCTGG + Intergenic
1012872899 6:104693055-104693077 GTGCACGCGCGCGCGCGCTGGGG + Intergenic
1012886513 6:104852227-104852249 GTGCGCGCGTGCGCGTGCACGGG + Intronic
1013401310 6:109799372-109799394 GTGTGCACGCACGTGTGCACAGG + Intronic
1013732655 6:113186499-113186521 GTGTGCGCGCGCATTTGCTGTGG - Intergenic
1014632353 6:123803243-123803265 GTGTGTGCGCGCGCGCTCGGGGG - Intergenic
1017175081 6:151494720-151494742 GTGTGTGTGCGCGCGCGCATTGG - Intronic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1018329956 6:162716755-162716777 GTGTGCGTGCGCGCGCGCGCAGG - Intronic
1019183150 6:170205167-170205189 GTGTGCACATGCGCGTGCATAGG - Intergenic
1020125282 7:5529921-5529943 GTCGGCGCGCGCGCACGCAGCGG + Intronic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1022151412 7:27611481-27611503 GTGTGCGCGCACACACGCAGTGG - Intronic
1022230775 7:28410151-28410173 GTGGGCGCGCGCCCGGGGAGGGG + Intronic
1023846500 7:44123770-44123792 GTTGGCGGCCGCGCGTGCAGGGG + Intronic
1026665604 7:72337393-72337415 GTGTGAGTGCGCGCGCGCCGAGG - Intronic
1029449595 7:100633393-100633415 GTGAGTGCGCGCGCGGGCGGGGG - Intronic
1029496324 7:100896987-100897009 GCGTGCGTGCGCGCGCGCGGCGG + Intergenic
1029640441 7:101816484-101816506 GTGCGCGCGCGAGCGGGGAGCGG + Intronic
1031011291 7:116526793-116526815 GTGTGTGTGTGCGCGTGTAGGGG - Intronic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1032496296 7:132365359-132365381 GTGCGTGCGCGCGCATGCATGGG + Intronic
1032525479 7:132576295-132576317 GTGTGCGTGTGCGTGTGCCGCGG + Intronic
1035368855 7:158365886-158365908 GTGTGTGTGCACGCGTGCATTGG - Intronic
1035368874 7:158366058-158366080 GTGTGTGTGCACGCGTGCATTGG - Intronic
1036930600 8:12951950-12951972 GGGAGCGCGCGCGCGGGCCGGGG - Intronic
1037878411 8:22560871-22560893 GTGCGCGCGCGCACGCGCCGTGG + Intronic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1038729009 8:30110379-30110401 GCGTGCGCGCGTGTGTGTAGTGG + Intronic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1044488667 8:92785610-92785632 GTGTGTGTGCGCGCGTGCATAGG - Intergenic
1045287780 8:100806878-100806900 GTGTGTGCGCGCGCACGCACAGG + Intergenic
1045710320 8:104975561-104975583 GTGTGCGCATGCACGTGCAGGGG - Intronic
1047423565 8:124727079-124727101 GTGTGCGCGCGCGCGCGTGGGGG - Intronic
1047423567 8:124727081-124727103 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1049420970 8:142516477-142516499 GTGTGCGCGCGCGTGTGTGCGGG + Intronic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1050091283 9:2017556-2017578 GTGTGTGCGCGCGCGAGCGGCGG + Intronic
1050305242 9:4299629-4299651 GTGTGCGCGCGCGTCTGCGAGGG + Exonic
1054785600 9:69207113-69207135 GTGTGTACGCACGCATGCAGTGG - Intronic
1055158921 9:73100353-73100375 GCGCGCGCGCGCGCGTGCATAGG + Intergenic
1056341589 9:85639350-85639372 GTGTGCGCGTGCGCGCGCATGGG - Intronic
1056782705 9:89563267-89563289 GTGTGCGCGTGCACGTGCATAGG - Intergenic
1058110738 9:101028868-101028890 TTGTGCGCGCGCCCGTGGGGCGG - Exonic
1059269328 9:113062085-113062107 GTGTGCGCGCCCGCGTGCTTGGG + Intergenic
1059270464 9:113067530-113067552 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271601 9:113072980-113073002 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272732 9:113078424-113078446 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273866 9:113083866-113083888 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059274999 9:113089310-113089332 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059790038 9:117632135-117632157 GCGCGCGCGCGCGCGTGTATTGG - Intergenic
1060283377 9:122228494-122228516 GGGAGCGCGCGCGCGAGCGGGGG - Intronic
1061052165 9:128203380-128203402 GTCTGGGCGCGCGGCTGCAGCGG + Exonic
1062325560 9:136010925-136010947 GTGTGTGCGTGTGTGTGCAGGGG - Exonic
1062560361 9:137138968-137138990 GTGTGAGCGCGTGCCTGGAGGGG - Intronic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1186349899 X:8731008-8731030 GTGTGCGCGCGCGCTTGTGTGGG - Intronic
1186490596 X:9969424-9969446 GTGTGTGTGCGCGCGTGCACTGG - Intergenic
1187265002 X:17723769-17723791 GTGCGCGCGCGTGCGCGCATGGG + Intronic
1188095865 X:26020644-26020666 GTGTGTGCGCGCGCGTGCATGGG - Intergenic
1188597812 X:31922522-31922544 GTGTGCGCGCGCGTGCGCTAGGG + Intronic
1189310604 X:40014818-40014840 GCGCGCGCGCGCTCGTGGAGCGG - Intergenic
1190201419 X:48364838-48364860 GTGTGCGCTCGTGCGTGCACAGG - Intergenic
1192148312 X:68696334-68696356 GTGTGTGCGCACGTGTGCATGGG + Intronic
1194035534 X:88866236-88866258 GTGTGTGTGCGCGCGCGCAAAGG + Intergenic
1194035536 X:88866238-88866260 GTGTGTGCGCGCGCGCAAAGGGG + Intergenic
1197655139 X:129108644-129108666 GTGTGTGTGCGCGCGCGCGGCGG + Intergenic
1197655141 X:129108646-129108668 GTGTGTGCGCGCGCGCGGCGGGG + Intergenic
1197782488 X:130171888-130171910 GTGCGCGCGCGCGCGTGAAGGGG - Exonic
1197782490 X:130171890-130171912 GTGTGCGCGCGCGCGCGTGAAGG - Exonic
1199737646 X:150698663-150698685 GTGTGCGCGCGCGTGTAGACAGG - Intronic
1200338075 X:155373462-155373484 GTGTGCACGCGCACGTGCTTAGG - Intergenic
1200348394 X:155467232-155467254 GTGTGCACGCGCACGTGCTTAGG + Intergenic
1201765676 Y:17571588-17571610 GTGTGCGTGTGCACGTGCATAGG - Intergenic
1201835876 Y:18334401-18334423 GTGTGCGTGTGCACGTGCATAGG + Intergenic