ID: 1032013411

View in Genome Browser
Species Human (GRCh38)
Location 7:128360970-128360992
Sequence GTGTGCGCGCGCGCGTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032013411_1032013417 23 Left 1032013411 7:128360970-128360992 CCCCTGCACGCGCGCGCGCACAC No data
Right 1032013417 7:128361016-128361038 GAGCCACTCTCCTCCCTGCATGG 0: 1
1: 0
2: 3
3: 23
4: 344
1032013411_1032013418 24 Left 1032013411 7:128360970-128360992 CCCCTGCACGCGCGCGCGCACAC No data
Right 1032013418 7:128361017-128361039 AGCCACTCTCCTCCCTGCATGGG 0: 1
1: 1
2: 1
3: 26
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032013411 Original CRISPR GTGTGCGCGCGCGCGTGCAG GGG (reversed) Intronic