ID: 1032015877

View in Genome Browser
Species Human (GRCh38)
Location 7:128380233-128380255
Sequence GAGGAGTCTTACCAGTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032015870_1032015877 10 Left 1032015870 7:128380200-128380222 CCGGGGGCAAGGAAGAGATGCAA No data
Right 1032015877 7:128380233-128380255 GAGGAGTCTTACCAGTGGCTGGG No data
1032015868_1032015877 21 Left 1032015868 7:128380189-128380211 CCAGGACAGGGCCGGGGGCAAGG No data
Right 1032015877 7:128380233-128380255 GAGGAGTCTTACCAGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032015877 Original CRISPR GAGGAGTCTTACCAGTGGCT GGG Intergenic
No off target data available for this crispr