ID: 1032016164

View in Genome Browser
Species Human (GRCh38)
Location 7:128381588-128381610
Sequence CAACCAGCAGTGACCCCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032016164_1032016172 27 Left 1032016164 7:128381588-128381610 CCAGGCGGGGTCACTGCTGGTTG No data
Right 1032016172 7:128381638-128381660 GGCCAAGGGCAGGAAAAGCTGGG No data
1032016164_1032016170 17 Left 1032016164 7:128381588-128381610 CCAGGCGGGGTCACTGCTGGTTG No data
Right 1032016170 7:128381628-128381650 TGTCTTTGAGGGCCAAGGGCAGG No data
1032016164_1032016168 12 Left 1032016164 7:128381588-128381610 CCAGGCGGGGTCACTGCTGGTTG No data
Right 1032016168 7:128381623-128381645 AGTCATGTCTTTGAGGGCCAAGG No data
1032016164_1032016174 30 Left 1032016164 7:128381588-128381610 CCAGGCGGGGTCACTGCTGGTTG No data
Right 1032016174 7:128381641-128381663 CAAGGGCAGGAAAAGCTGGGAGG No data
1032016164_1032016166 5 Left 1032016164 7:128381588-128381610 CCAGGCGGGGTCACTGCTGGTTG No data
Right 1032016166 7:128381616-128381638 CGAGTGAAGTCATGTCTTTGAGG No data
1032016164_1032016167 6 Left 1032016164 7:128381588-128381610 CCAGGCGGGGTCACTGCTGGTTG No data
Right 1032016167 7:128381617-128381639 GAGTGAAGTCATGTCTTTGAGGG No data
1032016164_1032016169 13 Left 1032016164 7:128381588-128381610 CCAGGCGGGGTCACTGCTGGTTG No data
Right 1032016169 7:128381624-128381646 GTCATGTCTTTGAGGGCCAAGGG No data
1032016164_1032016171 26 Left 1032016164 7:128381588-128381610 CCAGGCGGGGTCACTGCTGGTTG No data
Right 1032016171 7:128381637-128381659 GGGCCAAGGGCAGGAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032016164 Original CRISPR CAACCAGCAGTGACCCCGCC TGG (reversed) Intergenic
No off target data available for this crispr