ID: 1032016344

View in Genome Browser
Species Human (GRCh38)
Location 7:128382650-128382672
Sequence CTGGCCAGACAGATCTGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032016335_1032016344 14 Left 1032016335 7:128382613-128382635 CCTTGGCTTAAGGTGGCCCAGAA No data
Right 1032016344 7:128382650-128382672 CTGGCCAGACAGATCTGAGTGGG No data
1032016331_1032016344 27 Left 1032016331 7:128382600-128382622 CCTTGGTGACCTGCCTTGGCTTA No data
Right 1032016344 7:128382650-128382672 CTGGCCAGACAGATCTGAGTGGG No data
1032016336_1032016344 -2 Left 1032016336 7:128382629-128382651 CCCAGAAAGTTCCCCTGCCTTCT No data
Right 1032016344 7:128382650-128382672 CTGGCCAGACAGATCTGAGTGGG No data
1032016334_1032016344 18 Left 1032016334 7:128382609-128382631 CCTGCCTTGGCTTAAGGTGGCCC No data
Right 1032016344 7:128382650-128382672 CTGGCCAGACAGATCTGAGTGGG No data
1032016337_1032016344 -3 Left 1032016337 7:128382630-128382652 CCAGAAAGTTCCCCTGCCTTCTG No data
Right 1032016344 7:128382650-128382672 CTGGCCAGACAGATCTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032016344 Original CRISPR CTGGCCAGACAGATCTGAGT GGG Intergenic
No off target data available for this crispr