ID: 1032017111

View in Genome Browser
Species Human (GRCh38)
Location 7:128387367-128387389
Sequence GAAGCCAGGAGCTGCAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032017111_1032017119 15 Left 1032017111 7:128387367-128387389 CCACTCCTGCAGCTCCTGGCTTC No data
Right 1032017119 7:128387405-128387427 ATCAGCGCCCTCACAGGGCTTGG No data
1032017111_1032017117 10 Left 1032017111 7:128387367-128387389 CCACTCCTGCAGCTCCTGGCTTC No data
Right 1032017117 7:128387400-128387422 TCTCCATCAGCGCCCTCACAGGG No data
1032017111_1032017116 9 Left 1032017111 7:128387367-128387389 CCACTCCTGCAGCTCCTGGCTTC No data
Right 1032017116 7:128387399-128387421 CTCTCCATCAGCGCCCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032017111 Original CRISPR GAAGCCAGGAGCTGCAGGAG TGG (reversed) Intergenic