ID: 1032017112

View in Genome Browser
Species Human (GRCh38)
Location 7:128387372-128387394
Sequence GCGAGGAAGCCAGGAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032017112_1032017119 10 Left 1032017112 7:128387372-128387394 CCTGCAGCTCCTGGCTTCCTCGC No data
Right 1032017119 7:128387405-128387427 ATCAGCGCCCTCACAGGGCTTGG No data
1032017112_1032017123 29 Left 1032017112 7:128387372-128387394 CCTGCAGCTCCTGGCTTCCTCGC No data
Right 1032017123 7:128387424-128387446 TTGGACACTTCACAGCTGCTGGG No data
1032017112_1032017122 28 Left 1032017112 7:128387372-128387394 CCTGCAGCTCCTGGCTTCCTCGC No data
Right 1032017122 7:128387423-128387445 CTTGGACACTTCACAGCTGCTGG No data
1032017112_1032017117 5 Left 1032017112 7:128387372-128387394 CCTGCAGCTCCTGGCTTCCTCGC No data
Right 1032017117 7:128387400-128387422 TCTCCATCAGCGCCCTCACAGGG No data
1032017112_1032017116 4 Left 1032017112 7:128387372-128387394 CCTGCAGCTCCTGGCTTCCTCGC No data
Right 1032017116 7:128387399-128387421 CTCTCCATCAGCGCCCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032017112 Original CRISPR GCGAGGAAGCCAGGAGCTGC AGG (reversed) Intergenic