ID: 1032017114

View in Genome Browser
Species Human (GRCh38)
Location 7:128387389-128387411
Sequence CGCTGATGGAGAGGCTTGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032017114_1032017124 23 Left 1032017114 7:128387389-128387411 CCTCGCAAGCCTCTCCATCAGCG 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1032017124 7:128387435-128387457 ACAGCTGCTGGGAGAAAGAATGG No data
1032017114_1032017123 12 Left 1032017114 7:128387389-128387411 CCTCGCAAGCCTCTCCATCAGCG 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1032017123 7:128387424-128387446 TTGGACACTTCACAGCTGCTGGG No data
1032017114_1032017122 11 Left 1032017114 7:128387389-128387411 CCTCGCAAGCCTCTCCATCAGCG 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1032017122 7:128387423-128387445 CTTGGACACTTCACAGCTGCTGG No data
1032017114_1032017119 -7 Left 1032017114 7:128387389-128387411 CCTCGCAAGCCTCTCCATCAGCG 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1032017119 7:128387405-128387427 ATCAGCGCCCTCACAGGGCTTGG No data
1032017114_1032017125 28 Left 1032017114 7:128387389-128387411 CCTCGCAAGCCTCTCCATCAGCG 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1032017125 7:128387440-128387462 TGCTGGGAGAAAGAATGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032017114 Original CRISPR CGCTGATGGAGAGGCTTGCG AGG (reversed) Intergenic