ID: 1032017115

View in Genome Browser
Species Human (GRCh38)
Location 7:128387398-128387420
Sequence CTGTGAGGGCGCTGATGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032017115_1032017126 27 Left 1032017115 7:128387398-128387420 CCTCTCCATCAGCGCCCTCACAG No data
Right 1032017126 7:128387448-128387470 GAAAGAATGGAATGGACCCAAGG No data
1032017115_1032017122 2 Left 1032017115 7:128387398-128387420 CCTCTCCATCAGCGCCCTCACAG No data
Right 1032017122 7:128387423-128387445 CTTGGACACTTCACAGCTGCTGG No data
1032017115_1032017123 3 Left 1032017115 7:128387398-128387420 CCTCTCCATCAGCGCCCTCACAG No data
Right 1032017123 7:128387424-128387446 TTGGACACTTCACAGCTGCTGGG No data
1032017115_1032017125 19 Left 1032017115 7:128387398-128387420 CCTCTCCATCAGCGCCCTCACAG No data
Right 1032017125 7:128387440-128387462 TGCTGGGAGAAAGAATGGAATGG No data
1032017115_1032017124 14 Left 1032017115 7:128387398-128387420 CCTCTCCATCAGCGCCCTCACAG No data
Right 1032017124 7:128387435-128387457 ACAGCTGCTGGGAGAAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032017115 Original CRISPR CTGTGAGGGCGCTGATGGAG AGG (reversed) Intergenic