ID: 1032017117

View in Genome Browser
Species Human (GRCh38)
Location 7:128387400-128387422
Sequence TCTCCATCAGCGCCCTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032017109_1032017117 14 Left 1032017109 7:128387363-128387385 CCAGCCACTCCTGCAGCTCCTGG No data
Right 1032017117 7:128387400-128387422 TCTCCATCAGCGCCCTCACAGGG No data
1032017108_1032017117 21 Left 1032017108 7:128387356-128387378 CCTCTCTCCAGCCACTCCTGCAG No data
Right 1032017117 7:128387400-128387422 TCTCCATCAGCGCCCTCACAGGG No data
1032017111_1032017117 10 Left 1032017111 7:128387367-128387389 CCACTCCTGCAGCTCCTGGCTTC No data
Right 1032017117 7:128387400-128387422 TCTCCATCAGCGCCCTCACAGGG No data
1032017113_1032017117 -4 Left 1032017113 7:128387381-128387403 CCTGGCTTCCTCGCAAGCCTCTC No data
Right 1032017117 7:128387400-128387422 TCTCCATCAGCGCCCTCACAGGG No data
1032017112_1032017117 5 Left 1032017112 7:128387372-128387394 CCTGCAGCTCCTGGCTTCCTCGC No data
Right 1032017117 7:128387400-128387422 TCTCCATCAGCGCCCTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032017117 Original CRISPR TCTCCATCAGCGCCCTCACA GGG Intergenic