ID: 1032017118

View in Genome Browser
Species Human (GRCh38)
Location 7:128387403-128387425
Sequence AAGCCCTGTGAGGGCGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032017118_1032017124 9 Left 1032017118 7:128387403-128387425 CCATCAGCGCCCTCACAGGGCTT No data
Right 1032017124 7:128387435-128387457 ACAGCTGCTGGGAGAAAGAATGG No data
1032017118_1032017122 -3 Left 1032017118 7:128387403-128387425 CCATCAGCGCCCTCACAGGGCTT No data
Right 1032017122 7:128387423-128387445 CTTGGACACTTCACAGCTGCTGG No data
1032017118_1032017123 -2 Left 1032017118 7:128387403-128387425 CCATCAGCGCCCTCACAGGGCTT No data
Right 1032017123 7:128387424-128387446 TTGGACACTTCACAGCTGCTGGG No data
1032017118_1032017126 22 Left 1032017118 7:128387403-128387425 CCATCAGCGCCCTCACAGGGCTT No data
Right 1032017126 7:128387448-128387470 GAAAGAATGGAATGGACCCAAGG No data
1032017118_1032017125 14 Left 1032017118 7:128387403-128387425 CCATCAGCGCCCTCACAGGGCTT No data
Right 1032017125 7:128387440-128387462 TGCTGGGAGAAAGAATGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032017118 Original CRISPR AAGCCCTGTGAGGGCGCTGA TGG (reversed) Intergenic