ID: 1032017119

View in Genome Browser
Species Human (GRCh38)
Location 7:128387405-128387427
Sequence ATCAGCGCCCTCACAGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032017108_1032017119 26 Left 1032017108 7:128387356-128387378 CCTCTCTCCAGCCACTCCTGCAG No data
Right 1032017119 7:128387405-128387427 ATCAGCGCCCTCACAGGGCTTGG No data
1032017113_1032017119 1 Left 1032017113 7:128387381-128387403 CCTGGCTTCCTCGCAAGCCTCTC No data
Right 1032017119 7:128387405-128387427 ATCAGCGCCCTCACAGGGCTTGG No data
1032017112_1032017119 10 Left 1032017112 7:128387372-128387394 CCTGCAGCTCCTGGCTTCCTCGC No data
Right 1032017119 7:128387405-128387427 ATCAGCGCCCTCACAGGGCTTGG No data
1032017111_1032017119 15 Left 1032017111 7:128387367-128387389 CCACTCCTGCAGCTCCTGGCTTC No data
Right 1032017119 7:128387405-128387427 ATCAGCGCCCTCACAGGGCTTGG No data
1032017114_1032017119 -7 Left 1032017114 7:128387389-128387411 CCTCGCAAGCCTCTCCATCAGCG No data
Right 1032017119 7:128387405-128387427 ATCAGCGCCCTCACAGGGCTTGG No data
1032017109_1032017119 19 Left 1032017109 7:128387363-128387385 CCAGCCACTCCTGCAGCTCCTGG No data
Right 1032017119 7:128387405-128387427 ATCAGCGCCCTCACAGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032017119 Original CRISPR ATCAGCGCCCTCACAGGGCT TGG Intergenic