ID: 1032017120

View in Genome Browser
Species Human (GRCh38)
Location 7:128387412-128387434
Sequence GAAGTGTCCAAGCCCTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032017120_1032017127 22 Left 1032017120 7:128387412-128387434 CCCTCACAGGGCTTGGACACTTC No data
Right 1032017127 7:128387457-128387479 GAATGGACCCAAGGACATCCAGG No data
1032017120_1032017128 26 Left 1032017120 7:128387412-128387434 CCCTCACAGGGCTTGGACACTTC No data
Right 1032017128 7:128387461-128387483 GGACCCAAGGACATCCAGGCAGG No data
1032017120_1032017124 0 Left 1032017120 7:128387412-128387434 CCCTCACAGGGCTTGGACACTTC No data
Right 1032017124 7:128387435-128387457 ACAGCTGCTGGGAGAAAGAATGG No data
1032017120_1032017125 5 Left 1032017120 7:128387412-128387434 CCCTCACAGGGCTTGGACACTTC No data
Right 1032017125 7:128387440-128387462 TGCTGGGAGAAAGAATGGAATGG No data
1032017120_1032017126 13 Left 1032017120 7:128387412-128387434 CCCTCACAGGGCTTGGACACTTC No data
Right 1032017126 7:128387448-128387470 GAAAGAATGGAATGGACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032017120 Original CRISPR GAAGTGTCCAAGCCCTGTGA GGG (reversed) Intergenic