ID: 1032017121

View in Genome Browser
Species Human (GRCh38)
Location 7:128387413-128387435
Sequence TGAAGTGTCCAAGCCCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032017121_1032017128 25 Left 1032017121 7:128387413-128387435 CCTCACAGGGCTTGGACACTTCA No data
Right 1032017128 7:128387461-128387483 GGACCCAAGGACATCCAGGCAGG No data
1032017121_1032017127 21 Left 1032017121 7:128387413-128387435 CCTCACAGGGCTTGGACACTTCA No data
Right 1032017127 7:128387457-128387479 GAATGGACCCAAGGACATCCAGG No data
1032017121_1032017126 12 Left 1032017121 7:128387413-128387435 CCTCACAGGGCTTGGACACTTCA No data
Right 1032017126 7:128387448-128387470 GAAAGAATGGAATGGACCCAAGG No data
1032017121_1032017124 -1 Left 1032017121 7:128387413-128387435 CCTCACAGGGCTTGGACACTTCA No data
Right 1032017124 7:128387435-128387457 ACAGCTGCTGGGAGAAAGAATGG No data
1032017121_1032017125 4 Left 1032017121 7:128387413-128387435 CCTCACAGGGCTTGGACACTTCA No data
Right 1032017125 7:128387440-128387462 TGCTGGGAGAAAGAATGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032017121 Original CRISPR TGAAGTGTCCAAGCCCTGTG AGG (reversed) Intergenic