ID: 1032017122

View in Genome Browser
Species Human (GRCh38)
Location 7:128387423-128387445
Sequence CTTGGACACTTCACAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032017112_1032017122 28 Left 1032017112 7:128387372-128387394 CCTGCAGCTCCTGGCTTCCTCGC No data
Right 1032017122 7:128387423-128387445 CTTGGACACTTCACAGCTGCTGG No data
1032017115_1032017122 2 Left 1032017115 7:128387398-128387420 CCTCTCCATCAGCGCCCTCACAG No data
Right 1032017122 7:128387423-128387445 CTTGGACACTTCACAGCTGCTGG No data
1032017114_1032017122 11 Left 1032017114 7:128387389-128387411 CCTCGCAAGCCTCTCCATCAGCG No data
Right 1032017122 7:128387423-128387445 CTTGGACACTTCACAGCTGCTGG No data
1032017118_1032017122 -3 Left 1032017118 7:128387403-128387425 CCATCAGCGCCCTCACAGGGCTT No data
Right 1032017122 7:128387423-128387445 CTTGGACACTTCACAGCTGCTGG No data
1032017113_1032017122 19 Left 1032017113 7:128387381-128387403 CCTGGCTTCCTCGCAAGCCTCTC No data
Right 1032017122 7:128387423-128387445 CTTGGACACTTCACAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032017122 Original CRISPR CTTGGACACTTCACAGCTGC TGG Intergenic