ID: 1032017123

View in Genome Browser
Species Human (GRCh38)
Location 7:128387424-128387446
Sequence TTGGACACTTCACAGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032017115_1032017123 3 Left 1032017115 7:128387398-128387420 CCTCTCCATCAGCGCCCTCACAG No data
Right 1032017123 7:128387424-128387446 TTGGACACTTCACAGCTGCTGGG No data
1032017118_1032017123 -2 Left 1032017118 7:128387403-128387425 CCATCAGCGCCCTCACAGGGCTT No data
Right 1032017123 7:128387424-128387446 TTGGACACTTCACAGCTGCTGGG No data
1032017112_1032017123 29 Left 1032017112 7:128387372-128387394 CCTGCAGCTCCTGGCTTCCTCGC No data
Right 1032017123 7:128387424-128387446 TTGGACACTTCACAGCTGCTGGG No data
1032017113_1032017123 20 Left 1032017113 7:128387381-128387403 CCTGGCTTCCTCGCAAGCCTCTC No data
Right 1032017123 7:128387424-128387446 TTGGACACTTCACAGCTGCTGGG No data
1032017114_1032017123 12 Left 1032017114 7:128387389-128387411 CCTCGCAAGCCTCTCCATCAGCG No data
Right 1032017123 7:128387424-128387446 TTGGACACTTCACAGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032017123 Original CRISPR TTGGACACTTCACAGCTGCT GGG Intergenic