ID: 1032017125

View in Genome Browser
Species Human (GRCh38)
Location 7:128387440-128387462
Sequence TGCTGGGAGAAAGAATGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032017121_1032017125 4 Left 1032017121 7:128387413-128387435 CCTCACAGGGCTTGGACACTTCA No data
Right 1032017125 7:128387440-128387462 TGCTGGGAGAAAGAATGGAATGG No data
1032017115_1032017125 19 Left 1032017115 7:128387398-128387420 CCTCTCCATCAGCGCCCTCACAG No data
Right 1032017125 7:128387440-128387462 TGCTGGGAGAAAGAATGGAATGG No data
1032017118_1032017125 14 Left 1032017118 7:128387403-128387425 CCATCAGCGCCCTCACAGGGCTT No data
Right 1032017125 7:128387440-128387462 TGCTGGGAGAAAGAATGGAATGG No data
1032017120_1032017125 5 Left 1032017120 7:128387412-128387434 CCCTCACAGGGCTTGGACACTTC No data
Right 1032017125 7:128387440-128387462 TGCTGGGAGAAAGAATGGAATGG No data
1032017114_1032017125 28 Left 1032017114 7:128387389-128387411 CCTCGCAAGCCTCTCCATCAGCG 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1032017125 7:128387440-128387462 TGCTGGGAGAAAGAATGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032017125 Original CRISPR TGCTGGGAGAAAGAATGGAA TGG Intergenic