ID: 1032017126

View in Genome Browser
Species Human (GRCh38)
Location 7:128387448-128387470
Sequence GAAAGAATGGAATGGACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032017121_1032017126 12 Left 1032017121 7:128387413-128387435 CCTCACAGGGCTTGGACACTTCA No data
Right 1032017126 7:128387448-128387470 GAAAGAATGGAATGGACCCAAGG No data
1032017120_1032017126 13 Left 1032017120 7:128387412-128387434 CCCTCACAGGGCTTGGACACTTC No data
Right 1032017126 7:128387448-128387470 GAAAGAATGGAATGGACCCAAGG No data
1032017115_1032017126 27 Left 1032017115 7:128387398-128387420 CCTCTCCATCAGCGCCCTCACAG No data
Right 1032017126 7:128387448-128387470 GAAAGAATGGAATGGACCCAAGG No data
1032017118_1032017126 22 Left 1032017118 7:128387403-128387425 CCATCAGCGCCCTCACAGGGCTT No data
Right 1032017126 7:128387448-128387470 GAAAGAATGGAATGGACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032017126 Original CRISPR GAAAGAATGGAATGGACCCA AGG Intergenic