ID: 1032017128 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:128387461-128387483 |
Sequence | GGACCCAAGGACATCCAGGC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1032017120_1032017128 | 26 | Left | 1032017120 | 7:128387412-128387434 | CCCTCACAGGGCTTGGACACTTC | No data | ||
Right | 1032017128 | 7:128387461-128387483 | GGACCCAAGGACATCCAGGCAGG | No data | ||||
1032017121_1032017128 | 25 | Left | 1032017121 | 7:128387413-128387435 | CCTCACAGGGCTTGGACACTTCA | No data | ||
Right | 1032017128 | 7:128387461-128387483 | GGACCCAAGGACATCCAGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1032017128 | Original CRISPR | GGACCCAAGGACATCCAGGC AGG | Intergenic | ||