ID: 1032027566

View in Genome Browser
Species Human (GRCh38)
Location 7:128455805-128455827
Sequence GAGGGTACGCGCACGCGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 27}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032027566_1032027575 3 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027575 7:128455831-128455853 GGGCGTGCTCGCGGCTATAAGGG 0: 1
1: 0
2: 0
3: 1
4: 7
1032027566_1032027579 14 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027579 7:128455842-128455864 CGGCTATAAGGGGCGGAGGCTGG 0: 1
1: 0
2: 0
3: 15
4: 96
1032027566_1032027580 15 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027580 7:128455843-128455865 GGCTATAAGGGGCGGAGGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 131
1032027566_1032027576 4 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027576 7:128455832-128455854 GGCGTGCTCGCGGCTATAAGGGG 0: 1
1: 0
2: 0
3: 0
4: 7
1032027566_1032027578 10 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027578 7:128455838-128455860 CTCGCGGCTATAAGGGGCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 22
1032027566_1032027577 7 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027577 7:128455835-128455857 GTGCTCGCGGCTATAAGGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 26
1032027566_1032027574 2 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027574 7:128455830-128455852 GGGGCGTGCTCGCGGCTATAAGG 0: 1
1: 0
2: 0
3: 0
4: 13
1032027566_1032027581 18 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027581 7:128455846-128455868 TATAAGGGGCGGAGGCTGGGCGG 0: 1
1: 0
2: 0
3: 22
4: 236
1032027566_1032027570 -6 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027570 7:128455822-128455844 ACCCTCCTGGGGCGTGCTCGCGG 0: 1
1: 0
2: 2
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032027566 Original CRISPR GAGGGTACGCGCACGCGCAC TGG (reversed) Intergenic
900671432 1:3857221-3857243 GCGGGGTCGCGCACGCGCAGAGG - Intergenic
920784776 1:209030680-209030702 GAGGGCACGCACAGGCCCACTGG + Intergenic
922501571 1:226100698-226100720 GTGGGTGGGCGCATGCGCACAGG + Intergenic
1073057942 10:100714044-100714066 GGGGGTACACGCAGGGGCACTGG + Intergenic
1075139495 10:119818610-119818632 GATGGAGCGCGCATGCGCACTGG + Intronic
1083317871 11:61827724-61827746 GGGCGTGCGCGCACGCGCCCCGG + Intronic
1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG + Exonic
1097854880 12:64452050-64452072 GTGCGCACGCGCACCCGCACCGG + Exonic
1105964592 13:25372574-25372596 GGGCGCACGGGCACGCGCACAGG - Intronic
1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG + Exonic
1152595716 17:81236682-81236704 CAGGGGCCGCGCACGCGCTCAGG - Intronic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
1176157069 20:63627207-63627229 GTCGGTCCGCGCACGCGCCCCGG - Intergenic
1181401507 22:22652835-22652857 GTGTGTGCGCGCACGTGCACTGG + Intergenic
1183683688 22:39349942-39349964 GGGGCGCCGCGCACGCGCACGGG + Intronic
985681782 5:1259474-1259496 GAGTGGACGCGGACGCCCACAGG + Intronic
985681865 5:1259824-1259846 GAGTGGACGCGGACGCCCACAGG + Intronic
986016392 5:3761300-3761322 GAGGGCACGTGCACACACACAGG - Intergenic
986976028 5:13395018-13395040 GTGTGCACGCGCGCGCGCACTGG - Intergenic
988676733 5:33440723-33440745 GAGGAAAGGCGCACGCGCATTGG + Intronic
1003234485 6:4283307-4283329 GAGTGTACCTGCACGTGCACGGG - Intergenic
1007760022 6:44127990-44128012 CAGGGGACGCGCACCTGCACCGG - Intronic
1011277200 6:85642968-85642990 GCGGGGGCGCGCGCGCGCACCGG - Exonic
1014137631 6:117907511-117907533 GAGGGTGCGCGCACTGGGACTGG + Exonic
1015724815 6:136289420-136289442 GAAGATATGCGCACGCGCACGGG + Intronic
1021044621 7:15907052-15907074 GTGTGTACGCACACGTGCACAGG - Intergenic
1023095288 7:36654112-36654134 GTGTGTACGCACACACGCACAGG - Intronic
1032027566 7:128455805-128455827 GAGGGTACGCGCACGCGCACTGG - Intergenic
1050204272 9:3181060-3181082 GCGGGTACACGCACGCCGACCGG + Intergenic
1050437853 9:5628956-5628978 GAGGGCCCGCGCGCGCGCTCTGG - Intergenic
1055397632 9:75891512-75891534 GTGCGTACGCGCGCGCGCGCAGG - Intronic