ID: 1032027566

View in Genome Browser
Species Human (GRCh38)
Location 7:128455805-128455827
Sequence GAGGGTACGCGCACGCGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 27}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032027566_1032027570 -6 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027570 7:128455822-128455844 ACCCTCCTGGGGCGTGCTCGCGG 0: 1
1: 0
2: 2
3: 5
4: 82
1032027566_1032027574 2 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027574 7:128455830-128455852 GGGGCGTGCTCGCGGCTATAAGG 0: 1
1: 0
2: 0
3: 0
4: 13
1032027566_1032027580 15 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027580 7:128455843-128455865 GGCTATAAGGGGCGGAGGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 131
1032027566_1032027579 14 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027579 7:128455842-128455864 CGGCTATAAGGGGCGGAGGCTGG 0: 1
1: 0
2: 0
3: 15
4: 96
1032027566_1032027581 18 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027581 7:128455846-128455868 TATAAGGGGCGGAGGCTGGGCGG 0: 1
1: 0
2: 0
3: 22
4: 236
1032027566_1032027578 10 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027578 7:128455838-128455860 CTCGCGGCTATAAGGGGCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 22
1032027566_1032027576 4 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027576 7:128455832-128455854 GGCGTGCTCGCGGCTATAAGGGG 0: 1
1: 0
2: 0
3: 0
4: 7
1032027566_1032027577 7 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027577 7:128455835-128455857 GTGCTCGCGGCTATAAGGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 26
1032027566_1032027575 3 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027575 7:128455831-128455853 GGGCGTGCTCGCGGCTATAAGGG 0: 1
1: 0
2: 0
3: 1
4: 7

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032027566 Original CRISPR GAGGGTACGCGCACGCGCAC TGG (reversed) Intergenic