ID: 1032027570

View in Genome Browser
Species Human (GRCh38)
Location 7:128455822-128455844
Sequence ACCCTCCTGGGGCGTGCTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 82}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032027564_1032027570 13 Left 1032027564 7:128455786-128455808 CCGGGCGTGCGTGCGGCCTCCAG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1032027570 7:128455822-128455844 ACCCTCCTGGGGCGTGCTCGCGG 0: 1
1: 0
2: 2
3: 5
4: 82
1032027563_1032027570 14 Left 1032027563 7:128455785-128455807 CCCGGGCGTGCGTGCGGCCTCCA 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1032027570 7:128455822-128455844 ACCCTCCTGGGGCGTGCTCGCGG 0: 1
1: 0
2: 2
3: 5
4: 82
1032027565_1032027570 -3 Left 1032027565 7:128455802-128455824 CCTCCAGTGCGCGTGCGCGTACC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1032027570 7:128455822-128455844 ACCCTCCTGGGGCGTGCTCGCGG 0: 1
1: 0
2: 2
3: 5
4: 82
1032027566_1032027570 -6 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027570 7:128455822-128455844 ACCCTCCTGGGGCGTGCTCGCGG 0: 1
1: 0
2: 2
3: 5
4: 82
1032027561_1032027570 29 Left 1032027561 7:128455770-128455792 CCACGTCGTGTGCGTCCCGGGCG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1032027570 7:128455822-128455844 ACCCTCCTGGGGCGTGCTCGCGG 0: 1
1: 0
2: 2
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032027570 Original CRISPR ACCCTCCTGGGGCGTGCTCG CGG Intergenic